Transcript

guca1g-201

ID
ZDB-TSCRIPT-131113-969
Name
guca1g-201
Previous Names
  • guca1g-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056468 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056468|OTTDARG00000039329|ZDB-GENE-050120-1 guca1g|OTTDARP00000044281 guca1g-001 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 888 bp
AGATTATGCCAAGTTATCTGTGAGGAGGAGAATGCAGCTC
GACACATTCGCCTGGACTGCCGTGGTCGTTTTCAGATTCA
CTTTTTCATATTGGCCAAAAACTGAACATGGGCCAGAATC
AAAGCGATGAAGAAGAAGAAGAAGTGGAGCTAACAGAAAT
CCAGCCTCTTTACACCAGATTCATGAAAGTGTGTCCCAGC
GGAGCTCTGCATCTGCATGAATTTCGCAGGATTTTCGGCG
TTCAGAGCTCATCAGAAGAGGAGGCTTTGTACATGGAGAC
CATCTTCAAGTCCTTTGATACAAACAGGGATAACGTCATA
GACTTTATGGAGTTTGTTGCCGCCGTCCATCTCGTTTTGA
GAGGAAATCTGGAGGACAGGTTGAAATGGTCTTTTAAAGT
CTATGATAGAGATGAGAATGGAAAGTTGGACAGACAAGAG
GTTATACATGTCATAAGGATCATTTGCAAGCTTAAGAAAA
ACAGAATCAACATGACTCCTGTGGAAATCTGTGACAGGAT
ATTTGAACTTTTAGATGAAAACAATGATGGTCAGATCTCA
TTGTCGGAGTTCCTGGAAGGGGCAGAAAAAGATGCCTGGA
TTATGGACCTCCTAAAACTGGACACCAATGCACGTGTCTG
GTTCAGGGACAACTTGGGGAAGAAAACATGAATTCTCAGG
CTACGGTCTAGACTTGGGGGGCCCAAACCTGCCTGGCCTT
TCGCAATCTTTCAGACGCCGGGCTCTGCAAACACTACAGA
CCTGCACTGGAGGTCAGATAATATTTGCCTTCTGTCATGA
GTGAAAACGTGCCTCATCAGACATTGATCGCGTTCATCGT
CATCCTCTACATGTGCTTCCGTTTTTTCATGGCGTGATGC
TGATGAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations