ZFIN ID: ZDB-TSCRIPT-131113-969
Transcript Name: guca1g-201
Previous Name: guca1g-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056468 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056468|OTTDARG00000039329|ZDB-GENE-050120-1 guca1g|OTTDARP00000044281 guca1g-001 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 888 bp
AGATTATGCCAAGTTATCTGTGAGGAGGAGAATGCAGCTC
GACACATTCGCCTGGACTGCCGTGGTCGTTTTCAGATTCA
CTTTTTCATATTGGCCAAAAACTGAACATGGGCCAGAATC
AAAGCGATGAAGAAGAAGAAGAAGTGGAGCTAACAGAAAT
CCAGCCTCTTTACACCAGATTCATGAAAGTGTGTCCCAGC
GGAGCTCTGCATCTGCATGAATTTCGCAGGATTTTCGGCG
TTCAGAGCTCATCAGAAGAGGAGGCTTTGTACATGGAGAC
CATCTTCAAGTCCTTTGATACAAACAGGGATAACGTCATA
GACTTTATGGAGTTTGTTGCCGCCGTCCATCTCGTTTTGA
GAGGAAATCTGGAGGACAGGTTGAAATGGTCTTTTAAAGT
CTATGATAGAGATGAGAATGGAAAGTTGGACAGACAAGAG
GTTATACATGTCATAAGGATCATTTGCAAGCTTAAGAAAA
ACAGAATCAACATGACTCCTGTGGAAATCTGTGACAGGAT
ATTTGAACTTTTAGATGAAAACAATGATGGTCAGATCTCA
TTGTCGGAGTTCCTGGAAGGGGCAGAAAAAGATGCCTGGA
TTATGGACCTCCTAAAACTGGACACCAATGCACGTGTCTG
GTTCAGGGACAACTTGGGGAAGAAAACATGAATTCTCAGG
CTACGGTCTAGACTTGGGGGGCCCAAACCTGCCTGGCCTT
TCGCAATCTTTCAGACGCCGGGCTCTGCAAACACTACAGA
CCTGCACTGGAGGTCAGATAATATTTGCCTTCTGTCATGA
GTGAAAACGTGCCTCATCAGACATTGATCGCGTTCATCGT
CATCCTCTACATGTGCTTCCGTTTTTTCATGGCGTGATGC
TGATGAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
guca1g-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056468 (1),  Ensembl_Trans:ENSDART00000067239 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH435361 (1) 896 nt
GenBank:EB956769 (1) 646 nt
GenBank:AY850386 (1) 564 nt
CITATIONS (2)