ZFIN ID: ZDB-TSCRIPT-131113-958
Transcript Name: si:dkey-52p2.5-201
Previous Names: dkey-52p2.5-001, ottdart00000056417

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056417 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056417|OTTDARG00000039298|ZDB-GENE-040116-1 arpc1a|OTTDARP00000044235 DKEY-52P2.5-001 LG_ CR854891.10 Danio rerio protein_coding PUTATIVE, 2984 bp
TTTCTCTATTTTTAGAATCAGAACAACAGATTTTTTGTTG
ATTTGCATGGAGCTCACAGTAGATATACTTTGCTTACATC
AACATTAATCGCTTTTTCTTGACGCCTGATGGTACAGAAT
ACTCCTTACCAAAACCGAAGAAGACATAATCATAAGACTT
ATAAACTAAAAATGTAGTATCTTTGGTGAAAGAGACACTA
CAAAGGAGTTATTTGGAGCATCATCAGGCTTCTACTGAAC
ATTGTTTTTGTTGTTTTTATCTTCCTTGTTCCTTGTATGT
TAAAAAAATCTTGCAAGACGTGTTTCAAACTTTATTACAC
CTTTCATTAAAACTTTACACACCTCATGCAGTCAATGCAA
CTTGAGGAAAATGGCTCGGACATCTGAGAACATGATTGGC
AAAGTATTATTTGTTCTGTTTCTGCTGTCAGGTCCAACCT
CTGTTTTAACTGATTTTCACTCACTGCAGATACTTGGAAC
CTACATTAAAGGAGACACCCTATTTCCCCAAATAAGTTTC
ACATTTATGCTGGACGACTTGACAGTAGGGCTTTATATTA
CAGAAAGAGATGAATTCATTCCACGAGATAATACTACAAA
TGAAGATGAGACTGTTTCTGACATGCTTGATAAAATAAAA
AATGAATTGCAGCCCTTATTGAAGGGAACATTAATATTTC
AGAACAGTACAGAGAGTCCTCAACTTTTTCAAATTGCCTG
GCATTGTGAGCTGTTGGACAATAATAAGACTGGACAAATG
ATTTTGAAGATTGCTTTTAGTGGCTCCACTACAGATGAAG
TGAGTTTTTATGGTAACAATTTTACATGTCAGTGCCAAAA
CAACATGGCAACTGTACCTTTGGAGTATTTCCAGATGCAA
TTTAAGAGTATATATTACCCAGTCTGCATGACTACCCTCG
GAGGTTATTTAGTAAAAAGACAAGTTCAAGTAAACAGAAA
AGTACAACCGAAAGTCAGACTGATTAAGAAAGTACACCCA
AAATCTGGAGGGTTTCGCTTGAGCTGTTTGGCGTCAGAAT
TTTACCCCTATTTCATCAACCTGACCCTGTTGAGAGATGG
ACAGCCTGTATCTGACCATGAGGTCACTGGAGGAGATCTG
CTGCCCAATGGGGACGGGACGTACCAGATGAGGAAGAGTC
TGGAGATCAGAGCAGACGAGAGAGAAAAACACAAATACAC
CTGCTCTGCCAAACACCTGGACAAAAACCTAGATGTTGAT
TTCGAATTTGACCCCAGTTACCCAGTTAAAATAGTGATTC
CCGTAGTGGTGCTTTTGTCTCTGGTGTTGGTGCTTACAGC
TGTCCTCATACACAAATGCATGAATAAACAAGCAGCATCA
CCGCCTGAACAACAGGAACCTATTGAGATGGGTGGAAGAT
TAAGGAAATGAAAAAGAACCAAGTACCAAGCATCTAGTGT
ATACCAAGCAGTGATTTTGACTCTAGTGTGTGTTGCACTG
CAACTAGAATATAATCTTGTGATAGCAAATTCATCTTCTG
TTATTTGTCTAGAGGTGGCTCATTTAGCCATAACTTCTGC
TTTAAAAGCAATATTATTTGTTGAATTTTGGATTTAGTTT
GCGGCTTTTCTTTTTTCCCTTTACAAACTGATGGCTCATG
CACTCAAGAGTTGATTTTATTACAATGAACAGAAATCTTA
ACACTTTTAAATGGTTTATTTGTATTTTTTTTTCCTTCAG
ACGTTGATGGGAAATTCAATGTTTGACTTGCTGTTAGTTA
GAATGAGTGGAATTTACCAGCAAATTTTTTTGTATTTTAA
ATTGTTCCTTTTTATTTTACATTTGAACCAATTTTTGTTT
TAGGTATTCTTTACACTAATATGCATTTGAAATATTGTTT
TATAAATGTAGAAAAAGGTGTGTAAAAAATATTTCTAAAA
ATGATTTCATACGCACAACAAACAAAACTGACAACTTCAT
GAGGCTAAAGTGAAGAAATTGAGACTGCAGGTGAGTTCTT
GAGAGAGTTCTTGGGTTATTTTTTAACTCTCGTCTCATTA
CCTGAACCTGTTGAAAGATGGACAGCTTGTTTTTCCAGCT
TTTTATCTTATTAATAATGGTACGATTCAACAGGACAAAA
CATCAATAACAGCAGCAATAAGAAAAGTAGTGACATTTTT
AATTGTTGTCTGCTTAATGTATGCATTGGTTTGTATCAGA
TATTTCAGCCAAAATGTGGACTAAACAAAAATAATTATTA
AGAGCCACCAGAAAATGTTGTTGATTTTCACATTGACTGA
ATTAATCTGCATTATTTCCTAGAAAAACTAAAACGTAACA
CACATATCAGTTGACATACCACAGTTTTGTGAACTGTGCT
TCCTTTAACCATTATTGTAAGTCCCTTTGAATTAAATAAA
TAAACAAACAATAAAAAATGATGATACAGAGGCCAGCTTA
ATTAAAGGACAAATAATGGCAGCATTGTGGCTCAGCGAAC
GGAAGTTATGAAATTAACTAAGGGCATACACCCCATAAAT
CCTTTGCCACTGCCAGAGTAACTGGCTGTTTATTCTGCTG
TGGCGACCCCTGAATCAGAAACTAAATAAAAGGATAGTAA
TTGAGTAATGGTCACACTTTTTACAATTAACAAACCATTA
GATCTTTAGCTCTTTCAGACCAATGGTTAGAGAGTATGGA
CTTGTAATTAAAAGGTCACAGGTTCGAGTCTTGGCACCAG
CAGGGATTGTAGGTTGAGGGGGTAAATAATGTGTGTCTGT
TCACTGCTGTATGGATTGAAAGCAAAGCACATGGAATTTC
TCTTTCCTTAAGAGGGTTTTGGGTAGAATGTACAATCGTA
CTATCATAAGTGCTATTAAACAACCAATATCCCAGAATTG
TAAGAAATAATTTAGTAGTTAATAGTAAAATAAAGTTTTA
CCCAAAGAATTATTGCCACAGAAGTGGTGAACATCCAAAG
AACAGATGAACCATGACGACTGAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-52p2.5-201 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056417 (1),  Ensembl_Trans:ENSDART00000156529 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC167955 (1) 3012 nt
CITATIONS (3)