Transcript

si:ch211-280a23.3-001

ID
ZDB-TSCRIPT-131113-951
Name
si:ch211-280a23.3-001
Previous Names
  • ch211-280a23.3-001
Transcript Type
lincRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056396 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056396|OTTDARG00000039282|ZDB-GENE-131121-419 si:ch211-280a23.3|no_translation CH211-280A23.3-001 LG_ CU571064.7 Danio rerio lincRNA NOVEL, 134 bp
GGATGCTTTTGTTACGGCACATGGCGAGAAGAAGACTGGG
CTGTCATCTCCAGCGAAGCGTCCTCCGCAAACGCACGTCT
GCGCTGAATAACTGTGGGGAGAAGAGCATTGACAACATCT
GCCGGTGGTTGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations