ZFIN ID: ZDB-TSCRIPT-131113-942
Transcript Name: kcnc1b-201
Previous Name: kcnc1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056366 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056366|OTTDARG00000039267|ZDB-GENE-080414-3 kcnc1b|OTTDARP00000044199 kcnc1b-001 LG_ CU394253.9 Danio rerio protein_coding KNOWN, 1797 bp
ATGGGCCAAGGGGACGACAAGGATCGCATCGTGATCAACG
TCGGAGGAATCAAGCACCAGACTTACCGCAGCACCCTGCG
CACGCTGCCCGGCACCCGGCTCTCCTGGCTGGCGGAGCCC
GACGCGCCGAACAACTTCGACTATGATGCGAACATCGGGG
AGTTTTTTTTCGACCGCCACCCGAGCGTTTTCGCGCACAT
CCTCAACTACTACCGCACGGGGAAGCTGCATTGCCCGGCG
GATGTGTGTGGACCGCTGTATGAGGAGGAACTTGCGTTTT
GGGGGATTGATGAGACGGACGTGGAGCCGTGCTGCTGGAT
GACCTACCGGCAGCACAGGGAGGCGGAGGAGGCTTTGGAC
AGTTTTACCGGGGGCGCTCTCGACCTCGGTCATGACGACC
CGGAGCCTGAAGGGGTCGTCGAGGCGGCTGAGGGGGATGA
GGGGGTCGAGATGACCCGGAGACTGGCGCAAGGAGACTCC
CCGGATAACCGATCTGGGCGATGGAGCAGATGGCAGAAGA
AGGCCTGGGCGCTCTTTGAGGACCCATACTCCTCTAAATA
CGCACGGTGGGTAGCATTTGCATCTTTGTTCTTCATTTTG
GTGTCCATTACCACATTCTGTTTGGAGACTCATGAGGCCT
TCAATCCCATCATCAACCGTACAGAGACCTATATGGAGGG
CAATGAAACTGTGGAGCGTATCTTCCCTGAGACGGAAACT
ATGGTGCAGTTAACCTACATTGAGGGAGTCTGCGTTGTGT
GGTTTACTTTTGAGTTTATAATACGAGTGACTACCTGTCC
AGACAAATTAAAGTTTTTGAGAAACACCCTTAACATCATC
GACTTTGTGGCCATCCTCCCCTTCTACCTTGAGGTGGGAT
TGAGTGGACTATCCTCCAAAGCTGCGAAAGACGTGTTGGG
TTTTCTTCGTGTGGTTCGATTCGTCAGAATTCTTCGTATC
TTTAAGCTAACGCGACACTTTGTGGGCTTGCGGGTACTAG
GGCACACACTCCGTGCCAGTACCAATGAATTCATCCTCCT
GATCATTTTCCTTGCACTCGGAGTTTTAATCTTTGCCACT
ATGATCTACTATGCTGAACGTATCGGAAGAAACCCTAATG
ATCCTGATGCTAGTAGCGACACGCACTTCAAGAACATCCC
TATTGGCTTTTGGTGGGCTGTGGTAACCATGACAACCCTC
GGCTATGGCGACATGTACCCTCAGACAACATCTGGAATGC
TAGTGGGTGCGCTGTGCGCCCTGGCGGGTGTGCTGACCAT
TGCTATGCCTGTTCCTGTAATTGTGAACAACTTCGGCATG
TACTACTCCCTAGCCATGGCGAAGCAAAAACTACCAAAGA
AAAAGAACAAACATATCCGACGACCGCCTCTACTGGGGTC
TCCCAACTACTGCAGGTCAGCTGTTAACTCTCCACGACCC
AGCACACACAGCGACACATGTCCCCTGGCTCAGGAGGAGG
TTTCAGAGATCAGATACCCAGATTTTAAAGTGAACGGGGA
GCCATCCAAAGCTGCCCTGGCCAATGAGGACTGTCCTCAC
ATCGACCAAGCGGTGTCACCCGAGGAAGTCTTCAGTCCGG
TGGACCGCGAGAGACCCTGCTTCCTGCTTACGGGAGGAGA
ACGAGCCAACCACACTGGGGGAAGAGTCAGGAAGGGTTAT
GAAAAGCCATGGAGCCACAGCAGCATGTCTGGAGGCGTGG
CCTCAGTGTCAGCCCTGCCCTGCAGCCCGCCCTGTCTCAT
GCAGCAGGTCCACTCTCCCATCCCATCCATCCTGTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kcnc1b-201 Contained in:
[BAC] CH73-334L12 (1)

Genome Resources: Vega_Trans:OTTDART00000056366 (1),  Ensembl_Trans:ENSDART00000073919 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)