Transcript

eef1e1-201

ID
ZDB-TSCRIPT-131113-863
Name
eef1e1-201
Previous Names
  • eef1e1-001
  • ch211-264n4.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056009 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056009|OTTDARG00000039052|ZDB-GENE-030131-4949 eef1e1|OTTDARP00000043934 CH211-264N4.1-001 LG_none FO681333.3,CT573369.9 Danio rerio protein_coding NOVEL, 1015 bp
GGCGGGACTAGAGAATCTCCACCAATCAGCGCCCGCTTAA
TGTAGTCCGTTGGTTTCCGGTGTGATCAAGATGGCGCTGC
GGGAGCTGAACTCGCTTGAGAGATTTCTAGGATTAAAAAA
GGCAAATAAATACAGCACGCAAGGAGGGAAAAAGGTCCCT
GTTCTCCAAAACAACAATGGGCCAGCATTGACTGGTCTGG
TTACTATAGCGTGTCATCTGGTTAAAGAAGCCAAGAGGCC
AGAGCTGCTAGGAGACGATGCTGAACAGAGAGCTGTGGTC
CAGCAATGGCTTGAACATCGAATAACAAAACTAGACAACT
GTTCTAAAGAAGAGGTCAAAGTTATATTGAAGGATCTTAA
CCGATACCTGGAGGACAAAGTTTACCTGGCTGGGAACGTC
TTCACCCTGGCAGACATACTCATGTATTACGGAATCCACC
ACATTATTGTGGAATTGGCTATACAAGAGAAAGAGTGCTA
TCTGAATGTCAGCAGATGGTTTGATCATATTCAACACTAT
CCAGGCATACGGCATCATTTGCCTCCTGTGGTGGTTCTGA
GGAACAGAGTTTACCCAAGTGGTCACCACTGAAGGTTTTG
GTTACTTACACGTCCAATAAGCCAGACCTTAAGATCTTCT
AAGGTAACAAGCTGACATGATGTTAACCCAAAACTTCAGT
ATAATTAAAGCAGGTTGTTTGTTTTCGTGAGCTGAATAAT
GGCTGCTAATAGTGTTATTTTATATGTTAGCTTAGCATGT
TTAAGGATTGGAGTATCTTGATCAATGATCAACATGAAAC
TGCCTTTTGTTAATGGAAAAGCAGCTCATTCTAATGTTAA
CTTATTAATAGTTTTTTGGATAAGGTAGTCAATGCTTAAA
ATAATAAAAAGAAATTCACAAAATTGTCCCTTATGCTTTT
GAACCCTTGGAAATTTGACATCATTGGCAGTTTTGGGACA
GAGGTCACCAATCTCGGTCCTGGGGGGCCGGTGTCCCTGC
AGGGTTTAGCTCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations