ZFIN ID: ZDB-TSCRIPT-131113-837
Transcript Name: jdp2a-201
Previous Names: jdp2a-001, ch73-240m14.4-001, si:ch73-240m14.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055858 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055858|OTTDARG00000038955|ZDB-GENE-131127-459 jdp2a|OTTDARP00000043788 CH73-240M14.4-001 LG_none CU694315.6,CU638738.6 Danio rerio protein_coding PUTATIVE, 1371 bp
GGTGAAAAATCGATGACAGAAGGCTCGGTTTTGGGTGAAC
TACCCATTTAAAAGGAAGTGCGACATAAATCATAACATGA
TTGGTGTGGAAGTTAATCGTAAATATAGGAATATTATAAT
TGACTTAGAATAGAATAAAAAGTCAAACATGTTTGGAACA
AGTGAGAAAACGCTGACAGAATGTTCAGTTTTGTGTGAAC
TACCCCTTTAAAAGAAGATGTGACCGACATCATCATAACA
TTTGGACACTTCAGTCAGCAGCGGAGGAGCTCGTATTCGT
CCGCGTGTCCAGACGCCGAGCCGGAATGTTTGTTTTCTGG
TTTCTAAGGGGTGGAGCGAGCCTCTGCTCCTCACTTCTGC
ACTTCTCCATGTGTGTTTTCCCTTGCACTTCATTTCTCCA
TCCTCCCTGCTGACGTCCGACTTCCGCATTCCTCGCTTTT
CCCGATCGGGGGGATCAGGGATCAGAGCTGATGCAACGAT
TCCCGCTTTTTAAGATATACTCGCGACCCCAGGCTGACGT
CACAAAGGGACTCCACTCGCTCACCTCGAGGCCGAAGTCA
GCTGTGGTCGCGGGTGTTTGTGACATGATGCCCGGTCAGA
TCCCGGACCCCTCAGTGACGGCGGGCTCTCTGCCCAGTTT
GGGCCCTCTAGCGGGCATTTCTGCCACCACACTCTCTGAA
CACCTGAAATATGCAGACCTCTGCCACATTGGGGCCATGC
TGTCCCCGTTACATCTACTGGGAAAACTGGGCAAGCGGAC
ACTCCCGATCAAAGCGGAGAAGGATGAAGAAGAAGAGCGG
AGGAAAAGAAGACGAGAGAAAAACAAAGTGGCGGCAGCAA
GATGTCGAAACAAAAAGAAAGAGCGGACCGAGTATCTACA
GAAGGAGTCTGAGCGTCTGGAGATGATGAACTCGGAGCTG
AAAGCACAGATCGAGGAGCTGAAGCACGAGCGGCAGCAGC
TCATACTGATGCTCAATCGCCACCGGCCCACCTGCATCGT
GAGGACGGACAGCATCAAGACCCCCGAGAAAGAGGCCAAT
CCGCTTCTGGAGCAGGCTGAGGCCAAATGAGGAGAACCAC
ACATTTCACATCACTGTTTACAGGTTAGCTCGTCTCCGGC
TAGCTCAAGCACTTGGCTCGAAGCACTTGGACATTTTAGG
CAAGAGCGAATGGCGTCCTCTGACCTGTGAGGTTGGAGAT
CTGAGACTCCACAAAACAAAAACATAGCGACGGATGGCCT
TGTCAAACTGAGGCTGTGTGTTGGCAGTTACAGAACTTTT
CAGGAGGGTTGAAAGTTTTTTTTAATGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jdp2a-201 Contained in:
OTHER jdp2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055858 (1)
  • Ensembl_Trans:ENSDART00000058707 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK398708 (1) 885bp
    GenBank:CT702758 (1) 784bp
    GenBank:EB976220 (1) 592bp
    CITATIONS (2)