header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-822
Transcript Name: slc39a9-201
Previous Name: slc39a9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055807 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055807|OTTDARG00000038917|ZDB-GENE-060314-3 slc39a9|OTTDARP00000043754 slc39a9-001 LG_ CU424460.17 Danio rerio protein_coding KNOWN, 1933 bp
TGCAGCTGAGGCGGGTGGCTTTTGTTTTGACGGCGATGTG
GCTCGGAAGTACTTCCCTCACACTGCCAACATCACAATCG
GCTAGTTAGCGCTCAGTGTTTGGTCGATGCTGCGGAATAG
GAAGAAAACCAGTTGAGTTTATAGCGACAAAACTGTGTCG
ACTGCTTGGGAATCATGATGCCCTTAAACGCGGCTTGAGG
TTAAAAAATCGGAATGTGACGAGCCTTCGCGGATCCGTTT
ATTCATGTTTATTCGCAGCCTGGTTGTTACGAATTTAGCC
CTTGCTAAGCGTGACGAGATTCTGTGTATTTAAAGTTGAG
CAACAGCGTTCAGATAATCGATCAGGTCAATGTACAAAGA
GCCCACAAGCCGCCTTAACAGCGGATGAGTTGTAGACGTT
ATTGTTTAATCACGCGATCTCCGAGGATACATGTTTTTAT
TTCGCTAGCTAACCAGCTAACACACCAATCCAAGTTAGAA
GGATCTGCTGTCATCAAAACGTCGACCGGTTGCACGGAGT
TTGTTGTTAAACTCCTGCTGTCATCTACAAACTGAGTCAG
CGGTGGAAGCTCAGCAGAAATGGACGACTTCAGCTCCATC
AGTCTGCTGTCTCTGTCGATGCTGATCGGCTGTTATGTGG
CTGGAACTATTCCGTTGGCTGTAAACTTCTCTGAGGAGAA
GCTGAAGTTGGTGACAGTGTTGGGAGCAGGGCTGTTGTGT
GGCACTGCGCTGGCTGTCATAATACCAGAGGGAGTCCATG
CTCTCTATGAGGAAATGCTGGAAGGTGTGCACAACCATGG
CCATGGGCAGGTGGAAGCAGAAGTTTCTGAGCAGAAGGTT
GCAGAAGGAGTGGTGAGACCCAGCGGTGAACACGGCCACG
GTCACGAGCAGCTCCACGCTTACATTGGGATTTCTCTGGT
ACTGGGCTTCGTCTTCATGCTGCTGGTGGATCAGATTGGC
AGCGCACACATGCACAGCAGTGATGATCCAGAAGCAGCAA
GGGCTGCTAGCTCTAAAATCACCACTACACTCGGATTGGT
CGTCCATGCTGCTGCTGATGGTGTTGCTTTGGGAGCGGCT
GCATCCACGTCTCAGACCAGCGTCCAGCTTATTGTGTTTG
TGGCGATTATGTTGCATAAGGCTCCTGCTGCATTTGGACT
CGTCTCTTTCCTCATGCATGCAGGTTTAGAAAGAAACCGT
ATACGCAAACATCTATTAGTCTTTGCTCTGGCTGCCCCTG
TTTTGGCTATGGTCACCTACGTAGGACTCAGTCAGAGCAG
TAAAGAGGCTCTCTCAGATGTCAACGCCACCGGTGTGGCC
ATGCTGTTCTCCGCCGGCACTTTTCTGTACGTGGCCACGG
TTCACGTTCTTCCAGAAGTGGGTGGGATGGGAGGCCACAG
CCACTCGCCTGGGGGGAGCGCAGGGAAGGGACTCAGCAAA
CTGGAGGTCGGTGCTCTGGTTCTTGGATGTCTGATTCCTC
TAGTTCTGTCCATTGGTCACCAGCACTAGTGTTCTTTACT
TGAAACATCATCAGAAGCAGGAAGCTTGAAAAGTGCGAAT
GGAACTTTAAACAGCATCGGCCAAACAACAACCTCACAGA
AGCGGTTTGAATCATGTCGGTTTCTTCAGGTTGGTGGTTG
GAGTGAACATTGCAGGAACTTTGCAGTCAGAAACCGGATT
TTGAGAAGCACCACTGGACTTCTGGGATGGACTGCCCTGA
CACTCCTGAAAAGCATTGTGGGATACCGAATACCGTACAC
GAATAAATACATCATGCGTCCAAGTCTCTTTATTTTTGCT
TCCATGGTGCTGGTTTAAAAAGAATCAGTTGTGGTTTGGT
TGTCATGTATACTTTAGATTTGGTGTTCTGTTGATCTTTA
TATGGAAAATGTCCATACATTTACAAAGATATTAAATTCA
TGGGTCCAAGGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc39a9-201 Contained in:

OTHER slc39a9-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055807 (1)
  • Ensembl_Trans:ENSDART00000103397 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090821 (1) 1915 bp
    GenBank:BC155153 (1) 1895 bp
    CITATIONS (2)