Transcript

zdhhc22-201

ID
ZDB-TSCRIPT-131113-803
Name
zdhhc22-201
Previous Names
  • dkey-204k5.3-001
  • zdhhc22-001
  • si:dkey-204k5.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055745|OTTDARG00000038876|ZDB-GENE-131127-476 zdhhc22|OTTDARP00000043708 DKEY-204K5.3-001 LG_none BX511263.7,BX546474.8 Danio rerio protein_coding PUTATIVE, 2607 bp
AACAACATGGTTCAGTGGTATTCAAAAAAGATGCGTATAT
AAAATGGCAAAGTCATGCAAAAAATACGTAAACACATTCA
TATTACCAGTGTTTTATACGTATTACTGTCTGTTATTACT
ATGTCTAGTGTTTCTGGATGCTGTCTTGTCTACACCAACA
GGCGGTGCTAAACCACTGAGACACACCGCGAACAGATGCT
CTGGGTATTACGAAATTATAACCAATTTGCCTTTTATGAA
TGAATCAAATGTGGTTTATCTGCTGTAGCACCGACGGCGA
GGGATGAACTACGGTGTTGATACAGCGGCTCCTCTCCTTT
AATCGGCGTCAGGCATGTTGTTCAAGATGGGGAAACTCAA
ACTACTCAACACGATTGCTCCTGCATACTTCTACGCTGCA
ACCGTGGTCACATTCGCTCTCCACTTCCTCCTTTTCACGC
CCACTATTTTCCAAAGCTCAGATGTGACTATAAATCCCGC
AATGCTGGCTCACATCAGTATCTTTCTATTCCTCATGGGG
AATGCGCTGGGTAATTACATCATGACTATACGGAACCCAT
CCGAGAGTGCCAACGAGACCGTTATCCCAGTCTGTTCACC
CGACTGCCCGGACAGAATTGATGCGCACTACCTCCTGAAT
GGACGCCACTTCTGTAAAGTGTGCAAAAAGGTGATTCTAA
AACGGGACCACCACTGCTTTTTCACTGGAAACTGTATTGG
GAACAGGAACATGCGCTACTTTATTATGTTCAGCATCTAT
ACGTCCAGCTCTTGTCTATATTCATTGGTAATAGGGGTGG
CATATCTGACAATAGAGTACTCTATTTCCTTCGAGAACCC
ATTGACGTTCCTCACTCTTCTGCCACTCTCAACTGGTTAC
TTCTTCCTTGGTTTGATTTCAGGTCTCCAGTTCTTTCTGG
TGATAATGCTGTACATCTGGCTGGGTATTGGATTAGTGAG
TGTTGGTTTCTGCTGTCAACAGCTTCTGCTAGTGGCCCGA
GGACAGACCTGGTGTGAACTGCAGAAAGGCCAGTTGTCGG
AGTGTCGTGGTACCTGGCGAGCAAACCTGACTGACGTTTT
TGGTTCCCATTGGGTTCTGGGACTTTTCGTGCCGGTTCCG
ACTGTCGAGACTGTACCTGGAAACTGGCAGGTCTACCATG
ATCACAAACACGACTGAAAACTTGCCAAATCACTCTGTTT
ACCTTAATTTGGACCATATAAGGGCTTCAGTTCATTTGAG
CAGCTTAAGCCCATCCAACAGATCTGCCTTTTTAGTGGAT
TTCTGTCATCACAGAGTAAATTAGGTGAGCGTTATATCAC
CAAGATGTGATAACATCCATATCTATGTCAATCAGCACTG
TGCTGAAACCCAATTTCAGCCCTAGTTTAGGGCAGCAGTG
ATTAGAAGCAGCAATGATAGAGGAGGTCAGGATTAAAGCA
TGGATGAGTTTAAACAGTATTTACAAAACATACATATTAG
GTAATCAGAACACATCAACAGTGGCCTGCTAAAATGTGGG
TGACTGTTAGATTTGTTTAAACTTGATTTGAATTTGATTA
TATGCTACAAGAACTTGAATTACAATATAAATTGGTATTT
AATTAATTATATGTGAATTTTAAATACTTTGTGGAAAATT
ATGCCGGTTTTCATCCACATATTTGATTTTGATGCAAATT
ATATACACTTAAAAAGTCAAACTTATGACTATATAACTAT
ACTATATGACTATATACATAGTATAACCTTCTACTATTGC
TTTTATTTCTTTTGAATCTTGTCAAGCCAGCAAGAAAGTA
AACCCTTCTTTAAAAGATTGGGTCAGTTATACAAGGAAGG
TTTACACAACTATTATTGACTAAAATTTTAAGACGTTTTT
TGCGTTTTGGCAATTTTGATTTTTTTTTATACAATAGCAG
CTTTTAAAAGTAAAAACACAATCTAATAGAGCCTCTTTAT
AAAGAGGCATAGCCACTTTACTGGACTGGGATGTGTAATA
CAGCTACAAAATATTACTATTTGAGACAAATGATGTTCTT
CAGAACTTTATATTGCTGAAAGAACACAAAGGTTCCACAA
ATATATCAAGCACAACATAGAAACATTTAAAATCAATTTC
AGATCGCATTACTGCTACATAAATTCTTCTTATTGAAGCC
TTGTTGAGCATAAACAGTACTGTATTGTATGACAAGAGTT
GCAGTTCTATTTAAATATCACTTACTGTGTGTGAACATCA
ATACATTTGAATGTCTTTTCTATCTAACATTCTCATGTCT
GCGTCCTGTTTGCTACCTCAAGTCAAATTCAGTTTAAATG
AGCAAAATTAGTTACCGAACCAGAATAAAACATTGGTATA
ATAGGTCATTTTGAATAGGTATTTCTGAATAGCTCACACA
CAGACCAATGTCCTTTATGTGTGACATTTTGTAACGGGTA
AGATTAATTTAAAGTGTAACAATGCATACTTGGCTAGATG
CAATTCTACAGTTAGGTACTAGATTGTTAGTAGATTATGT
TACTATATTTTATTAAATGATTATTTCCTATCAATCAAAT
GGCAGATACAGTGCATCCGGAAAGTATTCATAGCGCTTGA
GTTTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations