ZFIN ID: ZDB-TSCRIPT-131113-788
Transcript Name: slc4a1ap-201
Previous Names: dkey-16j16.3-001, slc4a1ap-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055699 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055699|OTTDARG00000038841|ZDB-GENE-080521-2 slc4a1ap|OTTDARP00000043678 DKEY-16J16.3-001 LG_none CR559929.5,BX324135.14 Danio rerio protein_coding PUTATIVE, 6884 bp
GGAAGGGAATTATTAAGGTGTAACACCAAACACACCAGAA
CGCGTTGAGCGAACAGTGTTCGCCGAACGCACGATGGAGT
TTGATGGCAGCGAACTGACAGAAAACATTCCCACTGAAAC
GATGAAAACGGAGAAAAGCCAGGACCCAGAAAATGGAAAA
ATCTGCGATTCTAAACAAGACATCACCAGCACAAACGAAA
CCGCTGACGATCCGTTTAAGAAACCCGTACTGACCCCTTC
TCTCGCGGTGAAGAAATCATTAGGACCCAGTAAGAAGCCT
ACAGAAGAAGTGAGCAGCAGCGTATCAGAAAATACAGACG
CAGATCATGATACTAAACACCTGCTGTCAACTGCAAAGGC
TAAAGACACAAAAATAGACCCATCGGATCATCCGCCATCC
GAGAGATTAAAGGAACCGAGAGTACAGCCGAAATCAAAAG
ACATCAGACCCAAGATCCCTCCGGCTGGTAAATTCCCTCC
GCTCCCGTACACCGAGCCCCCATGGGGAGCTGTCCCTGAC
ATCAACTACTCGTTTGAACTGCTGAAAAATGGAGCTATCC
TAGACACCGTCCCGCTGACCCACAGGAGTTATTTTGTGGT
GGGTCGGTTGCCTGTGTGTGATGTGTCTCTGGAGCACCCG
TCCATCTCTCGCTATCACGCCGTGGTCCAGTACCGGGGCA
GAGCCGGGCAGGAAGGCGTCGTGGGAGAGGAGAGGGGCTT
CTACGCTTATGATTTAGGCAGCACCCATGGAACCTTTATC
AACAAGAACAAAATACCACCTAAAACATACATAAGACTCC
GAGTGGGGCATGTTCTAAAGTTTGGGGGGAGCACACGACT
CTTTATCTTGCAGGGTCCAGAATTTGATGAAGAAGCCGAG
TCGGAAATGACAGTGACAGAGCTCAGAGAGCGTGCTAGAA
AACAGAGGGAAGAGCTGGAAAGGAGAATGATGGGGGATGG
CTCAGATGAGGAGGAAGAGAAAGAGGAGAGTGAAACCAGT
GCTTCAAAAAACACCTCAGAAGATGCTGGCTGCTCTTGGG
GAATGGCTGAAGAGGCAGCTCCAGAAGAGGATGATAATGA
GGAGAATCCGTTTGCCACCGAATTTCAGGAGGATCAAGAA
GCAGCTTATTTAAAAGATCCTAAAAAGGCCTTGCAAGGTT
TTTATGACAGAGAAGGAGAAGAATTGGAGTTTGAATATGA
AGACAAAGCCCATGGCACCTGGCTCTGCAGAATTAAGTTA
CCTGTGGATGATGCTGTGGGCAGGCAACTGGTAGCTGAGG
TCACTCACACAGGGAAAAAGAAAGAAGCGGCAGTTCAGTG
CTGCCTGGAGGCCTGTCGTATCTTGGAGGCCCGTGGCCTT
TTGAGACAGGAGGCAGTGTCTCGCAAAAGGAAGAAGAAGA
ACTGGGAAGATGATGATTTTTATGACAGTGATGACGACAC
ATTCCTTGACCGGACAGGTGTAGTGGAGAAGAAGCGAACA
GAGCGGATGAAAAAGGCCGGAAAGATTCAAGAGCGTCCTG
ATACATATGAGTCACTTCTAGCCAAGCTGGCTGATGTTGA
AAAAGAGCTGGCTGACACCGAGAAAAAGCTAAATTTATCT
GGGAAAGGAGGCTCCGGTTCATCCACCGAGGATCCTCTGG
ATGCTTTTATGACCGCTGTACGGAGCGAGGTTGCTCTGGA
TGGGGTGGAAAGAAAGAAGTTGCACTTACATATAGCCGAC
TTAAAGAAGGAAGGTCAGAGATTGAGCAGGCTAGTGGAGC
TGGCTAAACCCACACAGCTGCCTTCATTGCTGTCTAGCGG
ATCTCATACTCAGTCTTCAGACTCCGACAAACCTAAGAAA
TTATCTTTACCGATGTTTGGAGCCATGAAAGGAGGGAGTA
AATTCAAACTGAAGACTGGAACTATTGGAAATTTACCACC
AAAGCGGACAAGTTTGCCTCCAGAGCTCTTCACTATGAAG
GAAATGCCCCCTGGTGGTGAAGAAGAGGTAGAGGAGGAAG
AAAACAGCGAGGCAGAGGATGTGGTCACTGATGGGGACAT
GGAGGTTATACAGTCTGTAGAGACAGCCATCTCAGAACAC
TCTGCAGACAGTGCTGAGTCTCAGACACAACAACCTAAAG
AAGAGCATGAGGACCAGCCTGCTAAGACAGTGATTTCTCC
TAAAAAAGATGACCCTTCTCCAAAAGGAGTTAACAACAAA
GCCTCTAATGTCCAGAATCCAAAGACATGCGCAAAGAAGA
AAGTTATTGGCCCAAGCAAGCCTCCTGTGACCATGTCCAA
GCAGTACCCAGAGGACGACCCAGACTACTGTGTTTGGGTT
CCTCCATCAGGTCAGACTGGTGATGGTCGGACACATCTGA
ATGATAAGTATGGATACTGAAAACCGAAAAGGGGAGGCCA
TCTTCACTAAAATGGAGTCAACTCAACATTCATTCTAGTC
CAGTGGTCTTAAACTCAATTCCTGGAGTGCCACAGCTCTG
CATAGTCTAGCTTCAACTTTCTTCAACGCACACCTGCTTT
AAAGTCTTGAGCACCTTGATTAGTTGGATCAGCTGTGTTT
GATTAGGGTTTGACCAAAACTGTGCAGAGCTGCAGCCCTC
CAGAAATCGAGTTTGAGGCACATGTTCTAGACTTCGAAAA
GTGAACATCATTTTCTCTCTGCATCTGCGTTTTCACTCCA
TACAAGGAACATCGAGGAACACAAGCAGCACAGATGAGCT
CAGATGTTATTTGGACATGGAAACTGATTTTCACATCATG
CGATTTTCATTCGAATGCATTCATTTTCCACAACTGGCCT
GTTAGCCAAATGTCTAGGATGTTTTTGGGAGAGTTTTGGA
GTGGACATTGCTTAAAGGGTTAGTTCACCACAAAAATAAT
GAAAATTATGTTATTAATTGGTAATCCCCATGTCTTTTCA
AATCTTTGAGACCTTCATTCATCTTCAGTACACAAATGAA
GTTATTTAGGTGAAATCCGAGAGCTCCCTCATCTTCCATA
GACTGCAAGGTCCCCTATTTGCTGAAAGTTCAGAAAAGAA
CCATCCTCAAAACAGATCATACACTGTAATAAACAGTAAA
TCCTTCTCTTTAAAAGTGACAAGTTGATTTTACTTTAAAC
ATTTAAGTAATTCTTAAACCGGTTAAGTTCACTGAACTTG
TTTGTTTAGATTTAGGCACATAGCTCTTTTACCTAATAAA
TTCAAGGCAGTTTTATACTATAAAAAGTGATTAGTTGAAA
AAGTGAGTAAACACATTGCCTTCAAATTATTGAGAAAATG
AGCTATGTACTTTTAAAAACAAGTAAATGTAACACTTCTA
AGTGTTACAACAGAAATACTTAATTATTTTTTAAGTAAAA
TAAACTTTATTAAGTAATTGCTTTTTACAGTTTGCATTCA
GTGCTTCAATTGGAATATTATCAGATTATGAGAAAACGTT
ATCGCACACGTAAAACAAAAATAACTACTTTCTAAAAAAG
TTTTCTTATTTTCAGTGTCAGTTTTTTGTGCACATTCAAA
AGTCTTGTTTCTCGCCCGTGACCATGTCCAAGTACCCAGA
GGATGACCCAGACTACTGTGTTTGGGTTCCTCCATCAGGT
AAACATATACTTTTCTTCCCCCTTGTTGATTGTGATGATA
TTAAAGGAATAGTTCACCCAAAAATAAAAATTCACTCACT
ATTTACTCTCCCTAAAGTGATTCCAAATCTTTGAGTTTCT
TTCTTCTGCTGAACTCTAAAGATGATGTTTTGAAGAAAGC
TGAAAATCTGTAACCATTGACTTATCGCACACATATAACA
AAAATAACAAATTATTCAACATTTTCTTATTCTTAGTGTG
AGTATATTGTGCGCATTGAAAAGCTCCAGTTCCGAGCGCA
ACTCTCTCTGTTTGAAACAAAGCACAGGCGTATCTGTGGT
AAGCATGATATGTGAGTGTGCGCCCTATACTGACACTGAG
AAACTTTAATCAAAAAAATATTTTTGAATTTTGTAGCTTG
ATATTATTCCGATTGAACTACGGAAGGCGTATAGATCTAT
TTTGAGGACTCTTTTTAGTACCTCTCTGAAAATGTAGGAT
GAGGAAGCTCTCGGTTTACACCTAAAATATTTTTAATTGT
GTTCTGATCAACTTGAGTAGGAGTAATTAATGACATTTCA
TTTTTGGGTGAATTTATGCTTAAAGGTTTGCAAAAATGTC
TGTTTTCAGATCAGCATTTACTTCCGCATACTGTCCTATA
AGCTTGCAAATCAAAAACTTTCCACTGGTTGAGAAGTACT
AATTTTTCAAACTGTATTTTGGATTTATTTGTTGTTTTGC
AGTCCCGATTCTGAGCGCAACTTTCTCTGTTTGAAACAAA
GCACAGGCATATCTGTGATAAGCATAATATGTGAGCGTGC
ACCCTATACTGACACTGAGGATGAGGGAGCACTCGGTTTA
CACCTAAAATATCTTTAATTGTGTTTTGAGCAACATGAGG
TGGGAGTAATTAATGACATCATTTCACTTTTGGGTGAACT
AACAATTTAAGATTTGCAAAAAGGTCTATTTTTAGATCAG
CACTTCCGCATACTGTTCTATATGCTAGCAAATTAAAAAT
GTTCCATTGGTGTAGAAGAACTAATTTCTCTGAATCTGAT
TTTTTTGATTTTATTTGTTGTTTTTCTGCTCTTTCAGATA
CAATATATTTTATTTTGACTTTATATTTTCTTAATGACAA
TATCATGTCAGTTGTTTGATCACTGTCATTGGTGACAAAA
ATCTCATGTCACAATTTTCTGTTCTTGGATCATTTTAATA
AGCTTAAATGAAAAGTTCACACAAAAATGAAAATTCACTC
ACTATTTACTCTCCCTAAAGTGATTCCAAATCTTTGAGTT
TGTTTCTTCTGCTGAACTCTAAAGACGATATTTTTGAAGA
AAGCTGAATGTCTGTAACTATTGACTTATCACACACATAT
AACAAAAATAATAACTTTATTCAACATTTTCTTTTTCTCA
GTGTCAGTATATTGTGCGCATTCTAAAGTGCCACTTTCAA
GCAAAACCTTCTCTGTTTGAAACAAAGCATGGGCGTATTT
GTGGTAAGCATGATATGTGAGTGTGCGCCCTATACTGACA
CTGAGGAGAAGAAACTGTCAATATTATTTGTGTTTTTTAG
CTTGATATTATTCCGATTGATCCACTGAAGGCATAATGAC
CTGTTTCTGAGGAGTTTTTTCAGTACTTCTCTGAAAATGG
AGGATGAGGGAGCTCTCGTTTACACCTAAAGTTTCTTAAA
CTGTGTTTTGAACAACGTGAGGGGGAGTAGTTAAAGAAAT
AAATTTCTTTTTTTTTTTGGTGAACTATCACTTTAAGGTT
TGCAAAAAGGTCTATTTTCATTGTTGTTTATATCAACATT
TACTTCCGCATACTGTCCTATATGCTAGCAAAACAAAAAT
GCTCCACTGGTCTAGAAGATTTCTCAAACTGTATTTTGGA
TTTATTTTTATTTTTTTGCTGTTCTTTCAGATACAATATA
TTTCATTTTGACGTTATATTTTCTTAATGACAATATCATG
TCAGTTGTTTGATCACTGTCGTTGGTGACAAAAATCTCTA
GCCACAAATTTCCGTTCTGGGATCATTTTAAATAATCTTA
AAGGGACAGTTCACACAAAAATGAATGTACTCATCTACAG
GTCATTTGAGATCTAGGTGCCCTTTCTTTCTTCAGTAGAT
CATTAAAGACTATTTTTCTATCAATCTGTTGTGAATCTTT
TAATGGCAGTCAATGGGGACAGTCTTTTGAGATTAAAAAT
AAACACGTACAAACAAGTCCAAATCAATAGCCATGGCTCC
TGATGACACAGAGGTCCTCTGAAGCCAAACAATCAGTCTG
TGGACATTATTTACAAGATTAGCTTCAATCCACAGCTTGG
TCGAACAGATCTTGGCGCGATTATGCGAATGTAGTCCAGT
TGTATTCCTGTTGCTTTAAACCTTTCAGACCCTGTAACGT
GTCAGGTCATGTTATTTTCACAGGGCATTTCTCAAAATTT
AAAGCCTGCTGTACATAATCAATTCATATCGGAGATTTTG
TCACTAATCCTCATGTATTTGTCATCAAAACGTCAGGACT
ACATTTAGACATGCTGTGAACAGTTTGACCAGGCTGTGGA
TTAAGATTCATAATAATGTAAATACTGTTTAATTTTTTAC
ACAGAGTGATCGTTTTACTTTAGAAGGCGTCAATGTGTCA
TCAGAAGCCATGGCTATTGATTTGGAGTTGTTTGTATGTC
TTTATTTTTAATCTACCACCATTGAAAGCATTATACGGAT
CTACATATGGATGACCTATTGGGGGAGTAAGTTAACAGGA
AATTTTCATTTTTGGGTGAACTATCCCATAAAGCAAACTC
ATTGACCACTCCGTTGGCTGTTTGGTCATCCCTGCACACA
CTCCCTGCTCTGATTGGCTGAGTGGACACACACACTGTAT
GGCAAGAGCTCGCTTTTGGATGCAGTTCTGTTGACTACTA
ACGATGCCTCCTCAGAGAGAGGTGGCTTTACCAGCCATCT
GGACACTTCCTTGGCATTCTAGGATTGGGAGCAAGCTGTT
AATGAATCAGTCCGTCTGTGTGTGTGTGTTTGCATAAAAG
GCAGTGAAAGTGAGCTCTGTGCACATCATTTGTGTGTATT
CGCTGTTTCTTCATATTAATGAAGAGTGACTGTTGGTGAT
GTGTGAGAGTGTGAGCTGGCTTGGATTTTTTTAGGCCTAC
TTATTCACTGGTCTCTCTCAGTTTGTCCATCACTTTTAGT
TCTATTGAATTCTCCATTTGCTTGGAGACTTTTTGTATTT
TGTGTGTATGTCTACTTAAATAGACATTTTGCTTCTGTCT
CTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc4a1ap-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055699 (1),  Ensembl_Trans:ENSDART00000046003 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AI878160 (1) 548 nt
GenBank:BI842342 (1) 381 nt
GenBank:BI842155 (1) 363 nt
CITATIONS (2)