Transcript

si:ch211-132f19.7-202

ID
ZDB-TSCRIPT-131113-776
Name
si:ch211-132f19.7-202
Previous Names
  • ch211-132f19.7-001
  • si:ch211-132f19.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055656 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055656|OTTDARG00000038808|ZDB-GENE-130530-619 si:ch211-132f19.7|OTTDARP00000043644 CH211-132F19.7-001 LG_ BX323819.9 Danio rerio protein_coding PUTATIVE, 5420 bp
TTTGTTAACCAATTACCTTCACACATAAACTCACCTGTCA
TGGACATTATCCTGTTAGCGGTGACCATGAGGCCCTAATA
GATCACGTGTGCTATTGCTGAGTAGATAATCCCTTATGTT
TCAACCTATTACGGAGCGTATGTGTGTGTTAATGTGCATG
TGCATTAGATCCCAAACTCCTCTGTCGCTGCCACAGTGTC
GAGTTCAAGTCCACTTATTTTTGCCTCTAAACATTTCCAT
CAAGAGTCAAGATTCTTCTGTAGGATAAGCTCCAGCAGAT
TGGGCTCTACCTTTGGGAAGGGGTCACGGCAGCTTTCAGA
CCATCTGGCCGAGCAATCACTTCATTACCTGAAGACAGCC
TGAGTCAATCAACTGCAGACGGGACATCTTTTAAAACTGG
GCTTGACTTCTTCCAAAACCAAGGAATGTTTTGAGACAGG
ATTTTATGGATTATAATTGTGGAGAGTATTATTATAGAAG
ACAAGTCTTATTTATATATATGTAGCTATGCTTTGCATAG
TCATGCTGCTTGGAATGGCAGAAGGAAAATCTGTCAAAGA
CGACTCATTCTGCACTCAGCTGCCAAATATTACACCGCTG
AGGGACAAGAATGTACCATATTAGATATTTGCTTGTGTCT
GGATCAGTTCACCTTGGCTACTGTTCCTGGATGAGCCGAT
GCATGCATCGTTACCGGTTTTTTTCAAGCCCCATCCTTGG
TTCGTGCAGTTGATAGAAGTCTCAAGCTGAGTTCTGGGAT
CTAAAGCCTGTTTAGATCATGGCTTTGAATTCTTCAGAAA
TCACTGTTCCACCTCAAGTTTGCACAATTGTGCCTCCATC
ACCCAACTTGAAACGCAAGCAACTAATGTGGCAGAATGCT
GTACGTCACATTATTGACCAACGAGGAATGCACCACGAGG
GGCGAGCGGTCAACTCTCGCAAAATCATTGTTACTGACGC
CTACATCGATGACATCAACAGACAGATTCGGAACAAAGCT
GCACGGGGCAATGCTGGCATGCATAAGCGGCGCTCCTCTG
CAGCTCGCATCCATCCATTTCGAGAACGCAACTCCACCTG
CACACGGAAGTCAACAGAATCAGTTACTGATGCAGACTTC
TTTGTAAGCTGGGGCTCCACAGTGCGTGGCATCTTCCTCC
CTGCTCTCCACCACAAGTTCAAATCTCACGATCTGGAGCA
TTTGTACCAGCAGCACTCATCTGGCCAACGGCGAACTTCC
CTCGTAGTCACTAATGTAATTGATATTCTTACCAAACTCC
ACATTATCTTCATCTACCTGGCTTTGGCCCCTGAGATGGT
GGACTCTCAACATGGATGGTTGGCCGGGCTCTTAATGGCG
CTCGGAGCGATCATATGTGTCTTAGTTCTGACTTGTAAAG
GACTGATGTCTCCAGATTACCTTCGCTATGCCGGGCTGGC
AAGCTGGCTGTCACAGACTGTTCAAGCGCTGGGGGGACTG
GTGTACGGATTGGAGACAGACCAGTCGTGGTATGTGCTCT
TCACCCTTTTTGCCATCTACACACTATTGCCCCTACCTCT
GCTGTGGTCCATCTGCATGGGATTCCTCACTGCTGCCTTG
CACCTGTTTGTGGATACCTTTAAGAACTACAATGACACAG
CCATTGTAAGAAAGTTACTAGCGAAAGGTCTATTGTACAT
GGGCATGAATACTGCAGGGCTTTTCATCCACTATTTATCC
GATCGTGCCCAAAGGCAGGCCTTCCTTGAGACACGGCGCT
GCATTGAGGGTCGAGTCAAGATGGAGAGAGAGAACCAGAG
ACAGGAGCGCTTGGTGATGTCTATTCTTCCTCGGTTTATT
GCTATGGAGATGATTGGTGATATGACTGCCCTGGATGATG
AATTGCTTCCTCAACAGTTCCATAAAACTTACTTTCATCA
ATACAAAGATGTCAGCATCCTGTTTGCTGACATAAAAGGC
TTCACCTCTCTCTCCATGACCATGCCGGCTCAAGAATTGG
TGCGGACTCTCAATGAGCTGTTTGGTCGCTTTGATCGCCT
TGCAGAGGAGAATCACTGCATGAGGATAAAGATTCTTGGA
GATTGTTACTACTGTGTGTCTGGGGTTCCAGAGCCCCAGA
CTGCACATGCCCGCTGCTGTGTAGAAATGGGTCTGGCCAT
GATCAACACTATACGTTATGTGCGCAAAGAGCTGAAGAGA
GATATGGACATGCGTATTGGAATCCACTCTGGCTCTGTCC
TGTGTGGGGTTTTGGGTCTTCAGAAATGGCAGTTTGACGT
GTGGTCTTGGGACGTAGATGTTGCCAACATGCTAGAGGCT
GGAGGAATCCCAGGGAGGATTCATATATCGCGAGCAACCC
TGGACTGTCTCGAGGGTGTTTATGAGACGGAAGAGGGCCG
AGGACATGAGCGCAATGAGTTTTTACGCAAGCACAAGATC
GACACTTTTCTGATCCGCCACACACCCCAAGATGACAAAG
AGCCCCCTAAAGTCAGGAGAACTAGCAAAGATGAGACAAC
ATGGAGTGCAGAGCTGCCTTTTGACAACATCATCGGAATG
AACTGTATATTAGCCACGTTTACCAATGGCTCCTTGGTGC
ACCTGCCCAATCAGATTACTCCGCATTGTGCCGGGTCTCG
AGAAATCAACAAGAGAATCAAGCAAGCCATCGAGGTGCGC
AGCAGTGAACGAATGCGCAAAGAACACATCACACCCTTCA
CTCTAGTCTTCAAAGACACACACATTGAGGGAAAGTTTTC
TCAAATGAGAGATGAGATGTTCAAGTCCAATTTGGCCTGT
TCCTTCCTTCTGCTCCTCTTCATCATGGCTGCCCAAGCCC
TCATCCCTTCTCCACAATTCTTTCCCATGATAATCCAGTT
TTTAGTGTTCCTGTTTGTCTACATGCTGGTGCTTCTGGTC
ACTCTGGCTGAGGAATTTAAGCGCTCCCCGCCATATTTAC
AGCATCTGTGCTGCTGGATCCACGAGACCAAGAGCATCCG
GAACCTACTCACCCTCACTGCTATTGCTATTAACTTTGGT
GTAGCCTCCTGCAACATTTTTTGGTGTAACGGCACATTTG
AAGAGACTGAGAAAAGCAACAAGAACTCAGAACATGGTAA
ACAGTGGCCAGTAAACATCTGCACACATCCTGAGTTCTTC
GTTTTGAGTGGTGTGGTGGCAATGGTGACGTGTGCTGTCT
TCCTGAGGCTCAGCTGTCTGTTGAAGCTAGCAGTGCTGAC
GTTAGTCATTGCAGTTTACACATACCTCATTGAGGTTGCC
TTCCATGTGCTCTTTATCCGCCAACACCAAAACAGCCAAA
TTCAGAGATCTCAATACCTCAGACGGAAAGGCATTTCTGT
GCTGCTAATGGCCATGTTTGTTGTGGTCGTCCTTTACAAC
AGTAGACAGCTAGAAACTACATCCAGGCTTGACTTCCTGT
GGCGTCTGCAGGCCAGGCAAGAAGTGGAGGACATGAAGGA
ACTAAGGGAGCATAACGAGTGTCTGCTGTACAACATCCTC
CCTGCCCACGTCGCTCGCCACTTTCTCGAGAGAGACAGAA
ACAATGAGGATCTGTTCTCTGAATCGTACGAGCGAGTTGG
AGTGATGTTTGCTTCCATTCCAGGCTTTTCCGATTATTAC
GAGAAGAAAGAATTGATTCATCAAGACGTGGAGTGTCTGC
GTCTTCTTAATGAGATCATTGCTGACTTTGATGAGCTACT
GGATGAGCCTTACTTTCAGGACATTGAGAAAATCAAAACC
ATTGGCAGCTGCTACATGGCTGCATCGGGCCTTTCTCCTG
AGAAACAGGAATGTGAAGATGAGTGGGCTCACCTCAGTAC
ACTGGTTCTGTTCGCTTTGGCCATGCAAGAAACTCTGAAA
GAAATAAACAAACGCACCTCTAATGACTTCTGGTTGCGTG
TTGGTATTTCTCACGGGCCTGTAGTCGCTGGTGTGATTGG
TGCCACAAAGCCTCAGTATGATATTTGGGGCATGACTGTA
AATCTTGCTAGCCGAATGGACAGCACAGGGCTCAGTGGGC
GTATTCAGGTCCCAGAAGCCACCAGCCGTGTCCTGGCCGA
ACACGGCTTTATGCTGCAGCTTAGAGGGGAAATCTATGTC
AAAGGAGTTAGCGAGCGGCGGGGAGCGGTCCGCACATATT
TCGTAAGCAGCAGGGAACACAATTCAAGCTACGCTGAGAG
AAACACTAGCAGAGGGATCTCTCTCGGGAGAAACACTCTC
GCCGCTGTGGTCTTTTCCCTGGTGCAGGCCCGCAAGAAAG
AAGAATTACGAGAAGCCAATGGAGGATTTCATCTGAAGGA
CATGGCATGAATTCGGATTGAAAAGTGGACAGAAGCCATA
TTTAATACCTCTTCAGTTTTTTTAGACTGGTGTCTGAGTC
AATGCCTTCAAGTGATTTTCTGCATTCTCTGTCGTTCTTT
CTGAACGGTACCAACTTCACATCTCATATATAACCAGATT
TCTACAGGATTTCTTATTGTAACGGAAAGAACAAATTGCT
TCTAAAAGTCATGTTTCTTATGTTCTGGAAGTTTTTGAAT
CATGAAGTTGTGAGTTTATTATAGCAGAGCTGCAAATAAA
CACTTTATATTTTGGACAAGACCGTAACTGCAAAAACAAA
GGAACTCTGGATTAGATCAAACATGATGACTCATAGTTGG
GATTTCTGTATCTTTATCTGGATATTTTTCCCCATAGTTT
TCTGTAATCAACTGCCAATGAATTGTGAGAAATGAAGGGT
CTGACATCACCATTGCAAAAAGCTAATTGGCCTATTATCT
GATGCATGTGTATTAGTCAATGACACTCTGGAAAAGCTAT
AAATCTCAGGATTATTCATCCAGCTTAGACGACTTTCTAT
GAAAAGTAATATTTAGATTTTTTGTGCGTAATTGACCATT
TATAAACTCTTTTTATATGATGTTTACATGATCACATGAG
GTAGTGTGACAGGAAAAGCTTCTGTCTCTGTTTATTGTTT
TTAATGTTGTTGACTCAATATTGAGGCAGAATTACAATAA
CGTCACGGTGAATGCATAAAGCAGGAATTAACAATGCCAA
AGTTCTGTTTTAGACAATAAAGGTATATTTTTAGTGCACG
GTCCACCAAATTTTACTGAGTGCATTTTTTTTTTTTTTGG
TATTTTATTTTTAAATATATTTGGGTTCAGTGTTTGTCTG
ATTAAGCAGTTTTTGGAAGCAGATACAAACAGGCTAACAA
TAAACCTTTTTGCTATGCCGCATGATGCTTTTGGAGTAAC
TTCATTTAAACTGTAAATAATCTGTGAAAAAGATACAACA
ACTTGGTATACAATGAAGTGCATTTATTCTTCTTACAGTT
TATCTGTCAAATATCAAAAACAAAAAACAAAAAACTGATT
AGAATTAACAAAGTAGTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations