ZFIN ID: ZDB-TSCRIPT-131113-725
Transcript Name: zgc:165461-202
Previous Names: ch211-149k12.2-001, zgc:165461-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055456 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055456|OTTDARG00000038689|ZDB-GENE-050208-135 zgc:165461|OTTDARP00000043496 CH211-149K12.2-001 LG_ AL929195.14 Danio rerio protein_coding KNOWN, 1529 bp
AAATCTCTCTCACTGGCAGTCCCGAAGGAGCACTCGGCTT
GGCGCTGTCATTTTGTTTCTGTTCTAAGGGTGCTGTGTGT
GCCCTAGGGTTTTCTTCGTATTTTTGTTTTAAATGCTCTT
TATCAACACAGCCATGCGAGAGTGGAGTCTACTCTTTCTC
CTTTCCCTTCTCTTCCTCCTCCATTCATTCTCTGAGGCTA
AAAAGAAGCCCAGGCAGCCTTCAGAAGCAGTGGCCGGATC
AGACATCACACCCATAAATCCTTCACTGGGCTCAGGTCAA
CTAAGCACAAAGGACGGGCACCGCTGCACCTGGGAGACGC
TGGAAAGAGGAGCCAACATCGTCCTCCAGGTGAGCTGCTC
TGTGGCCGGAGAGGATGGACTTAAACATCCGTACACCTGC
CAGTTTGCTGGAAAACCTCAGGAATGCTCTGCGTACAATG
ACCAGTCGTCCCAGTACTGGAAGCAAGTGGTGAGCAAACT
GAAGAGGCGTGAAAACGCCTGTGAAGGGGAGAAAGTCCTG
AAAACCCGCCTGTGCAAGAAGGCTTCCAGTGTATCTCACA
TGAAACTCACAGAGAGAAGCGGAGTAGAGACGACTACGCA
CATGAGTGAGGGAACGCAAGACAGCAAACGGAAAACTGAT
GTTCCTGGGAGGAAAGAAAAAGACGTGCAGAAGGAAAAGA
AGGAGGAGGAGGAAGAAATGAAGAAAGACGAAGATGACGG
GGTCGAAGGAATAGTGAATGATGAATTCTCAGACATGGAG
CCTGCTGTGGGTTACTGCAGAGAGTCATGGCATTCTCTCT
GCAGATTCTTTGGCAAGTTTTTTGATGGTTAGGAAAGAGA
AACAGGATGATTTTTCGGATCGGGTGAAGAGTGAGAATGT
GTGGAGAAGATGGAAAGACAACAGTCAGGTGTCAGTAATA
CAACTTAGATGCTAGTATGCAGCCTGAATAAAAATAGGCC
TGTTGTTATGAGGAAGATGAATAGACATGGAGATAGTTTG
TGTAATATTTAACAATTACTGTAATCACACTGGCTGTTAA
TTTAACATGCATTATGTATGTATAAAACAAATGCTTTTCT
TATTTAGTTTGTGTCTTGTATCTAATCCAAATATCTATGT
ATTATCTAATGATAATAAATTAATAATAATACGTCAAAAT
GTTTAATAAAACAAGCCAAATAACCTGTCAGTGGGGTAAG
TAAAGGAATCTTGATTTTAGTTTTAATTGAGATTTTAATA
ACCCTATTGGCATATTATTTTGCTTGCTTAAAGTAAAAAA
GACATAATTTTGACTTATTATTTCTGAAAATAAAGCTTTA
TTTTTACATGTCTAGAAAATTCTTCTTGATTTAAGAATTT
TTAGATATTTGGATTAGAAGTAAAAAAAAAAACTGTATAT
CGGAACTAATCCTTAACTTTTTGTATATATAATTGTAACT
TGTATTTCACATGAGCACTGACTTTTTATTCGATATGAAA
ATTGTTGTATATGATTATACTTAAATCAATAAAAAATACA
TTTAAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:165461-202 Contained in:
[BAC] CH211-149K12 (1)

Genome Resources: Vega_Trans:OTTDART00000055456 (1),  Ensembl_Trans:ENSDART00000153652 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC146725 (1) 2538 nt
GenBank:BC154515 (1) 1526 nt
CITATIONS (2)