header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-720
Transcript Name: slc22a7b.3-201
Previous Names: ch211-183f23.2-001, slc22a7b.3-001, si:ch211-183f23.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055437 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055437|OTTDARG00000038674|ZDB-GENE-131120-103 slc22a7b.3|OTTDARP00000043482 CH211-183F23.2-001 LG_none BX511271.14,CT027715.6 Danio rerio protein_coding PUTATIVE, 1838 bp
ACCTTTGACATCCTATAAAACTCACTACATAAACCCAGGG
TTTTGTAGAGGAAGGCTGAGGACATTCTGTGCATCAACGA
AAACAACATGAAGTTTGAAGATCTAATTACGGAGATCAAT
GGCTTCGGCAGGTTCCAGAAGATGATTCTTTGCATCAGTT
TTGTAGGTCGATTCATCATCCCGTGTCACTTTCTATTAAG
CAACTTCATCGCCGCCATCCCGTCTCATCACTGCGACATC
AGCTTTCTAGATGCCGATGGGCTCTTTGGAAATCTAACTG
AGGAGGAGAGACTGATTGTCAGTGTTCCAACACAGGAAGA
CGGGAGTCCTGTTTCCTGTCACATGTTCTCTCATCCTCAG
TTTCAATTGCTGATAAACTCCTCCAGCAGCTCAGATCTTC
CAGTAGTGGAGTGTCAGAATGGATGGCACTTTGATAACAG
CACCTTTATCAGCACTCTCGCCACACAGTGGGATCTGGTT
TGTGATAACAGAGGTCTGAATAAAGCTGTGGCCACAATCT
TCTTTGTCGGTGTGATGTTTGGAGCAGCTTTTTTTGGAGG
CATGAGTGACAGATTTGGGCGTAAACCAATGCTGCTGGTC
TCATACATATCAGGAATGGCTTTTGCATTGGCCAGCGTCT
TTTCTACTTCCTTCACCATGTTCGCAGTGCTGAGATTCTT
CAGTGGATTCACTATTACTGGCATTGTTATTGTCTCTTCT
GTCCTCAATCTGGAGTGGGTGGACATTGAGCACAGGAGAC
TAGTGAGTATCATTGACAGTATGGCATGGGCTGTTGGGAG
CACCTCGTTGGCTCTGATTGCATACTTTATTCGAGACTGG
AGATGGCTGACAGTGGCTGTCACTTCACCTTTAGTGCTGT
GCACTATCCTTTGGTGGTGGGTTCCAGAGTCTGCTCGATG
GCTGATAGCCAATGGAGACGTGGAAAAAGCTCATTATTAT
CTGCATAAATGTGCCGTCATGAACCGTAAAGCTGAAGTTA
CATCAAGAATCAAACCTGAGGCTCTCGCTATCAGTGTTTC
AGATCAAGGAAAGAAAAAATATACGTACCTGGACCTTGTC
AGAACACCTAAGATGAGGAAACTGGCTATGCTCACAGGAA
CAGTATGGTTTTGTGTCGCCACTATGACCTATGGTATAAG
CCTCAATATCACAGGCTTTGGATTAAATATGTACCTCACT
CAGTTTGTTTATGGAGCCATTGAGGTTCCATCTAAACTGA
TTGTATATTATCTTCTGGAGAAAATTGGCAGGCGGAAGAC
TGAAGCAGGAGCTCAACTATTTGCAGGAATCAGCCTCATG
ATTAACATATTCATACCCAAAGATCAGTGGATTGGTCGTA
CTGTGGTTGCTGTTCTGGGTAAAGGCTTCGCAGTTGCTGC
CTTTTGCACAATTGTATTATATAGCTCTGAGCTTTACCCG
ACTGTTCTCAGGCAAAATGGCATGGGCTATAATTCCTTCC
TGGCTCGTCTGGGTGTTTCTGTGGCTCCTTTAGTCCTGCT
ATTGGACACTTTCTGGGGTCAGTTCTCTCAGACCATCTTG
TGCTCGGTGGCATTAATTGCTTCTGTGGTGGCTTGGAATT
TACCAGAGACTCGAGACAGGTGTCTACCAGAGACTATAGA
GGATGTTGAGGGCACTGGGAAAACTCCCAATAAAGATCAA
GAGAAGCAGGAGAACGAGGAGAAAATTGCAATGAATGAAC
CCCAGTGAACAGACCAGAGTTCAGTTTTACCAAATGGAAA
TTACACTTTGATGTTCTGTTGCTTAGTGTCATATTCAGAT
CCCAAGACAGTAAATGCGCACAAAAAAAGAAAGAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc22a7b.3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055437 (1),  Ensembl_Trans:ENSDART00000078873 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC152007 (1) 1780 bp
GenBank:CD759666 (1) 883 bp
GenBank:DN835026 (1) 792 bp
GenBank:BI473784 (1) 539 bp
GenBank:EB876789 (1) 284 bp
CITATIONS (2)