ZFIN ID: ZDB-TSCRIPT-131113-638
Transcript Name: espl1-201
Previous Names: espl1-001, ch211-233b16.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055133 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055133|OTTDARG00000038476|ZDB-GENE-030131-5188 espl1|OTTDARP00000043236 CH211-233B16.3-001 LG_ AL954698.9 Danio rerio protein_coding NOVEL, 7188 bp
CATATGGTGTATTTCCTCTTCCGAGACGTTTCCGCGGTTT
CCCGATAGGCTTTGCAGTATTTAAATATGTGCGCGGCTTC
GCTTTCCTACCGCTGCTGTCATCCAAATAACGGCGACACT
CCAGTAGAAAAATAAGACAATTTCACTTTTGTATACATGT
TGAGAAACGCTATATTTCATAACACTCAAAAAGAGTGTCC
TTTTCTCAGTATCTGACCGTTTAACCGAGCGCGGTAGCTG
ACAGGCTAACAGATACAACAATAATGGCATTAAAGAGCTT
GAAAACAGAAGATTACGTTCAGCAGTTATCCTGTGTCAAG
GACACCATAGTCCTCCACAACGAACTGAAGAAACATGTGG
ATGGTGGCTTGGGTCCTTATGGTCGCACAATGTGTGATCG
TATCATCAGAGCCTGCAACCAGCGGCTGGGCAACGGCGCT
GTGGATGCTGGCCTTCAGGAGCGGATAGTGGAGCTGGTGG
AACTGGCTGTCCAAGGGTTTCAACTGCTTGAAGAGTCCGG
CATGCAGAGCACCCCCTTTTATCTGGAGAAAATAGTCTTT
CACATCCTACAGAAAGTCGCAAGCCTTGGAGCTCATGGTC
CTGCTTGTCGACTGGGTCAGCTCGTGTATAGAAGACTGAA
ATGTTTGTCTGCAGAGATTGATGACTTTAATGTCCTGGTG
CGGAATTGCTTTGCAGTCTTGTGGAACAGTCTCCTCTCTA
ACAAACCGAGTGCTTCCACCCTCCCTCCACGAGACAGACT
CCACTGTCAGCTGCAAGCTTTAACATTCAGACTCCTTGAA
CAGGGCTCCAGCTCGTCCTCTTCCCCATCCAAAGTTCCTC
TGTTCGTGGAGGAAGCAGTAGTGGAGTACGAACGATCATG
TGGAGGTTTTACTCAAGACGATGTGAGTTTTCTGACCTCT
GAATTGCGTGAGCTGTTCTCTGGTGCTTTCATCAATCCTC
AGGACTCTGCATCAACTTCTTCACTGCTGGCTGTGTGGTG
TGAGGTGGCATTTAAAGTGTCTAAACTGCTCTGCAAAAGT
AGCTTTTCACCTGAGGCTGTTGAACTCTTGCGAGGCACTC
TGAAGGAGGTTAATGGCCACGTTGGCCTGCGTTCGGCTCT
GGGTCTGGCAGACCGGGCAGTGCAGATGCAGTGTGTGTTA
AGTTCTGGAGGTGAATGCAGTAAGAGCTTCACTGAATGTG
CCCGTGCTCTCCGGATGTTGCCTTGTGCCATGTCCAGCTC
AGAGTCTCATGCCCTGTTAGAGGCTTGTCAGCTGGTGGTT
TGGACGTTGGAAGCCAGTCAGTGTAAAGGAATGGATGTGA
CCACTTTGCTGGCTTGTTTTTCCTTTTTGGAAGAATATCA
GGAATTTCTGCTTGCACAGCAAAAGAACTCGTTTTCGCTG
CAGGTCCAATACTCTCTTTGTTTCAGTTTTTACCAGGGCT
TCATCTGCACATATGATAGTCTTCATGCTTCTCAGGTGTC
TGTGGGCGAGACCTTGGACAGAGTGCTATTGTTCTGCCGG
TCGACCGCAGGACGTATGCTTGCTGAACTGCGGACACTCA
ATAATGACAACTTGCTGCTTAAAGCAGTGTGTGCAGTGAA
TAATGTGGTGTACGAGCTGTTTAACAGGAAGCTGTATGAA
GGAGCCTTTGGATTGTCGATGATTGTGTGTCAGGAGCTCT
GTAAGGACTGCCCGCCCTCTCTTCCTATGGATCGGGTCAA
CCGCTGTTTCATGCTGACAGTGCAGTGTAGTCGCCGCGCA
GGCCATCTGGAGCAGGCTCTGGACTGGATTGTTCGCTGGA
TTCAGGCTTTGGGCTCACAGATTTTGGATCATCTCACTGA
ACCTGTGTCGATGTGGGTCAAAACTAAGTGTGATGCCGCC
AGAGCAGGCGAGGATGACACACGCCTGAGGACTCTGAGGG
ACGGGTTAGGAGAATCCTTAGTGGATGAGGAGGTTATGAT
GTGTTTGTTAGAGGAGGAGTTGCGTGTATATAAGGAGCAG
ACTGGAGACACAGCACAGGAACGCTACAACACACTCTGCG
ACCTCTTGGAAATCTGCCATGAAGAAACCCCACACACACT
AAGAAGAGCTACGTATCTGTGTGAGATGGCACAGGTTGTG
TGCTATCAGGACTTCAGCCAGCAGACTGACTGCTCAGCAG
TTGATTTTACCCACGAGGCTTTGCGGTTGCTGGAAGCAGA
ACCAGAGACGGCAGAGAATACTGATAGGCTGAAGGATGAG
AAAGCCCACGCTTCCCTGTGGCTCTATATCTGCACTCTTG
AGTCTAACCTGCAGGAGGCTGTGGACACAGAGAAGCGTTT
GTGTGCAGTGCAGGAGGAGAATAAAAGAGATGTGAATATG
GATCCTGTTCCCACAAATGATCTGGAGTACGAGGACAAAC
AGAAATCACAAGAGAGCCAGTTAGTCTACGATGGACTACG
CTTCAACCTGCTGGCTCACAGCAAGCAAAGTGAACCTCTA
GATAAATGTTTGTCTCTATGGCGGAGTCTCCTCAAGGGGG
CTGTGCCTGCAGTTAGAGACCCTAAACTCACAGCTTCTTC
CATGACTTTGATGGCTGCCCTATACACACTTATGGGCAAG
CACCTGCAAGCTCTGGAGGGATATCAGCTTGCTGCCACCC
TTTTCCATGTACTTGGTGATGGCCAGAGTAGTGCCAATGC
CTTCTGCCACTCTACCAGGATCTTGCTTTACCTGGGTTCA
CCGCAGCTTGCACAGGTGGACTTAGAAAAAGCAGAAAAGA
GCTTGTCATCTGTCACCATCTCTGAGGGCACATCTATTAT
CTCCATGCTGGCCATGTTGCAAAAAGCACAGCTACACTAT
GCTCTAGGACAGGTGGAGAGTGGCGTGTCCTGCCTGATGG
AGGTGATAAAGGAATCTGCTCAGCATCATTCTAAGAGCTG
GTACCTGCTCAGGGCTCGAGCACTGCAGACAGCCAGTGAA
TACTTGAGTCTGGACACACTGGCTTTGAACTCACAGCTAC
GCCAGAGCATCATGCAGCAGGGTCTAAAGACTCCAGACAC
TGCTCAATATGAAGGGTTGAAGCTGTTGTGTAGCCTGGTG
ATGATGTTATTGGGCAACGGGTTTTACGGAGCGCCTGGAC
CAAACACTGACACTCGCTTTGTGGATAAAGGAGACAGTGT
TGTGTTTAAGTGGCTGCTGCTGAGTGAAGTGCTGGTGTGC
TCGGAGAGAATGGTGATCACCAGGAGCAGCAGCGGAGCCG
TTCATGAAGCTAAAGCTCAGTGTCTAGAGGCTCTCAAACT
GGCCACCAAACTACAGACACTCAGCCACTGTGCTGAGCTG
TTGGTGCTGAAGGCAGAGCTGGAGCTGATGAAGGGTGCAA
CTGAAGCTAGTAGTTTAGACCTAGAGCAAGTTAGACATTT
ACTTGATCTCTGCACAGATTTTGGCCAGGGACGACAACAG
AAATCTGAAGTGAAAATCAAACCACGCAAAGGTCGTCCCG
CTGCCCCTTCTTCCTCTGGTCACATCTCTGAGGAAGAGGA
TGATCTGAGTGGGATCCTCAGCTCTCGTGCCCTTCCGAAG
GAGCCTGTGGAGAACATGGCTAGATTAGGAAGCCAAGGAG
CTTCTCCCCCTCTAAAGCCCAAATGCCAGCATGGCCTCTC
CTGTCTGACCCATGAAGAGACCTGCTCTTGTCTCTGCTGC
ACTGAGCTCAGCGTGGCTCGAGTCAGCATCCACTGGGCAC
TATTACAGGCAGATCTCCAGACAGATCCCGAACGCTCTCT
CAGACTACGCCAGTCTGCCAGGAAACGCTGCCGCTATGTT
GTAACTAAACTTCAGAGAAGTTTGGCAGCACTTGTACACT
CCAAAAAATCACCTAATGTCTGCTTGTCACTGCTTCAGGC
TGAACAGGGTAAAGTGCATCTGGGTGCTGTGCTTCAACTG
CTCAGAACTGGAGACAAAGGGAAAGCTGCCATCTTGTGGG
AGGAGATAGAAGCAGGATTAGAGGCAGTGACACCTAAAGG
AGCACTGACACCAGAACTTGGGCCTATCAGAGCTACTCTA
CTGGGGGCTAAAGCCGTAGCCTGCTGCTTGGCGTTGGCAA
TGAAGAAACAGTGTATACCCGAAGAGCTGTTTTCTTCATT
GTGGCACTGGAATCCACCAAAGGTTAAACCGCAATTAAAA
TCTAAGCATCGATCCAAGAGTCCGGACGCAGCTCCTCTAG
AGGCAGGTGTTAAACATAACCCTAAAGTTAAGAGTGGACT
TGAGGAGAATGAAAGCAGAAAAACCAAAGAGACCACTGTC
ATTTCGAAGAAAGCTAAAGACTCTGTGCCCAAAATTACCA
TCACAAAATCCTCCATGGTTTTTAAAACGCCCAAAGCAAC
GAGAACAACCCGGCCCAAATCTGTCTCCACTAGCACTGGC
ATCAGTGACCTGAGAGCATTTGACTTCAATAATGAGGTGC
CTGACATTTCAGTCAACTTCACACCATCATTACACCGATC
TACAAACCAAAGTGCGACTGCAAAGTCAAAAGCGTCCTCA
AAGGGTTCGTTCCAGGTTTACAAAGATTCTTCTCCTGCTG
CAGAGAAAGCTGTAGTTGTCCCGGCTGCTCCTAAACGAAC
AAAGCGTTCTCGCTTCAAGGTTGAGTTCAGCGATGAAAGC
GACAACGATGCTGCTCCTCTTGCTGTAATGGAAAAGTCAG
AGAAAAAGAAAAACACCTTTAAAACATCACGCACCTTGAA
ACCAACCCTTAACACCATCCCTAGTGACACCAAACTTGTG
AGCTCCACAGTAGATCCAGAACCCTCCAGACGAACACGGA
CCACTAAGAAAAGCACAGCTCTTCCCTCCATTGGTGGCCT
CTCTTCTGAGGAAGAACTTGGAGTATCTTCACAGACACGT
ACGCGTAGAGGACGACCAAAGAAGAGCACCAGCTCAGCAG
ACACAGAGGAGCCAGAGAGGATGAGGATGATTAAGGAGGA
AGAACAGAGGGTTCTTTTGAATGTCAGCATGGAGGAGCTC
AGAGGCTCTGACACTGAGACAAAAGACACTGGAAGTCCAG
ATGCTGACTGTGAGGTCTTGAGGAGAGATCTAGGTGCAGA
TTTTGGGCGAGAGTGTTTCAGTGAGCTCAGGAGAGCTGGA
CAGAATGGATCAGGATCTCACACAGCTCTGCCACATGCAA
CTACATCTCCTGCAGACTTGTCAGTAGAGACGGTCCAGTC
ATACCTGCGCTCCTCATGGCTCCTCCTGCACCACTTCCCG
TTTCCTTCTCTTTATCCTCACATCTGCTCATTACTCGCTC
AGTCATTCGGTCAAACGGACCCCATCATCACAGCAATGCT
GCATGCACAGGCACTGGGAGTGTCCACTCGCCACCATATG
ACCCGTCACGTGGTTAACCAGTTCAGAAAGTTGAAGAAAT
CCTGTAACGATGTAGCAGAAGGTCTTGGAGCTCTGAGTCT
GGAGGAAACATCTGGAGCAACGCAGTCAAAGAAACTCTCT
GCGTTGGAGCAGATCTTTTCATTCACAGCATCAAACCCAA
TGCAGTTTCCACAGACACACTGTCAGCAGTTCACACAGCA
GCTGGAAGATCTACCTGCAGGAGTGACCGTATGCTTGCTG
TCACTGACGGGGGTGCATCCTGATGAAATTGGCAACACTA
TTCTTCTGACCCGACTGGAGCGCGGCTCTACCCCAATCAC
AGTTCGAATCCCCACTGCAGACAGAGAGCAATCTGTTGCT
GGCCTGTTGGAAGAAATGGATGGAGTCTTGAAAGGACAAA
AGGAAGTGAGCACAGTGGCTGAGAAATCACAGTGGTGGGA
CGGAAGGAAGGCTTTAGATGCCCGTGTGGAGAAAATGCTG
GAGGAGATGGAAGAGGCTTTAGGAGTGTGGCGAACTCTTT
TTCTGCCTTTGACCTCTGATCCTAAGCTTGATGTTCAGGT
AAAGAGCCTCCAAAAGGCTCTTAAATCAACAAAGATCACA
CGGGACACTCTCAAGGTGATTCTATCAGCGTCTCCACTGC
TGTCCCTGCCAGACCTGCAGTGTCTTCTGGAAGGAATGAA
TGTGCAGGACAAGGACCTGCTGAAGCTCCTGCAGAGAGGC
GTGGCTGAACTGAGAGGGAGGGAGGAGCCACAGGGACACA
CTGTTCTGATTTTAGACAAGTACTTGCAGAGGTTGCCGTG
GGAGAACATTGCTTGTCTGAAGTCTCAGTCGGTCACTCGA
ATGCCCTCATTACACGCGGTGCTTGGACACAGTCATCTGA
GAGAGGTGGATACAAGTTGTGTTCTATCTTGTGGTGTGAA
CCCTAAGCAGGTTTACTATGTGCTAAACCCAGATGGAAAC
CTGCCCGACACTGAGAATCGCTTCAAAGAGTGGTTTACAG
GTGAACGAACATGGCAGGGGGTTTGTGGAAGGGCTCCTGA
TCCGGAGAAACTACAAGAGGCTGTGACCACTAAAGATCTC
TACATATACATCGGACATGGTGCAGGAGCCCGCTTTCTGG
ATGCGCAGAGAGTTTTGAAGGTGCCTGTGAGGACCGCAGC
TCTTCTGTTCGGCTGCAGTAGTGCTGCTCTCAGTGTGCTT
GGTCAGCAGGAGGGAACGGGCATCATCCTCAGCTACCTGA
CCGCTGGATGTCCATTGGTGCTGGGTAACCTGTGGGATGT
GACAGATCGTGACTTGGATCGATTCACATCGGCTCTGCTC
CAGTCTTGGCTCTCTGCTGGTTCTGGCTCTTCACTTCTTC
AGCATTTGGCGAAATCACGCAGCGCAACTCATTTAAAACA
CATAATCGGTGCTGCGCCCATTGCGTATGGTTTACCGGTG
CATATACACTAGTGCAGATTTTAAATGCAACTTTTCTTAT
TTACAGGTGCTATAGTGAATTTTTAATGTATGAATGATAC
TATCGGTAATTTAAGGTGTGATTTAACCTCCGGGTTTGTT
TGCTGTACAGGGATTAAGCTCTGTTTTTATTGAAATTAAT
CTTAAAATCTACGACTAGGCAAAACTTTAACATGTTTAAA
GTGTTTTGCAATTTTTAAGTCCTTTATTTTTTGTGTGTGC
AGTTGTGGATTTCGTTTGCTCATACCTCAAGATATTTTAT
CTTAACACTTTTGGTTTTGATGACTTTTGTGCAACTTTTC
TTTTACACTTTTTTTTCTGTTAAATTATATCAAATGTCGA
TCTGCATTAAAATAAAATGTTTATAGCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
espl1-201 Contained in:
OTHER espl1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055133 (1)
  • Ensembl_Trans:ENSDART00000156645 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI964195 (1) 1109bp
    GenBank:EG575129 (1) 939bp
    GenBank:EE717933 (1) 938bp
    GenBank:EG584104 (1) 926bp
    GenBank:CN319806 (1) 920bp
    GenBank:EE318088 (1) 903bp
    GenBank:CT691909 (1) 855bp
    GenBank:BI892436 (1) 721bp
    GenBank:CT626517 (1) 701bp
    GenBank:EB921969 (1) 701bp
    GenBank:BF156689 (1) 576bp
    GenBank:AI958818 (1) 563bp
    GenBank:BI891467 (1) 545bp
    GenBank:EB856951 (1) 403bp
    CITATIONS (2)