header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-63
Transcript Name: ei24-202
Previous Names: ei24-001, ch1073-74n1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046082 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046082|OTTDARG00000032912|ZDB-GENE-050417-457 ei24|OTTDARP00000036362 CH1073-74N1.1-001 LG_ CU633886.9 Danio rerio protein_coding KNOWN, 1890 bp
ACAGTGAACCCAAACTAGTAAGTCGAATTTTCCAGTGCTG
TGCCTGGAATGGAGGTGTATTTTGGCTAAGCCTGTTCCTG
TTTTATCGAGTGTTTATCCCGCTGCTGCAGTCTCTCACTG
CTAGAATTATAGGTGACCCTTCGCTGCATGGGAATGTGTG
GTCGTGGCTGGAGTTCATTCTGACATCTGTATTCAGTGCT
CTCTGGGTTTTACCGCTATTTGTGCTTAGCAAGATAGTCA
ACGCCATTTGGTTTCAGGACATTGCTGATCTGGCGTTTGA
AGTGTCTGGACGTAAAGCTCAACCTTTTCCCAGCGTCAGT
AAGATCATCGCAGACATGCTCTTCAATCTTCTGCTCCAGG
CTCTCTTCCTGATTCAGGGATGGATTGTGAGTCTCTTTCC
CATCGATGCTATTGGTCAGCTGGTCAGTCTCCTGCACATG
TCTCTGCTCTACTCGCTTTACTGCTTCGAATATCGCTGGT
TTAATCACGGAATTGAAATGCACCAAAGGCTGTCAAACAT
CGAGAGGAACTGGCCGTATTATTTTGGCTTCGGTTTGCCC
ATGGCTCTACTGACCGCTCTGCCCTCTTCATACATCATAA
GCGGTTGTTTGTTCTCCATTCTCTTCCCGCTCTTCATCAT
CAGCGCTAATGAAGCAAAGACCCCAGTCAAGCTCTACCAC
TTCCAGCTCCGGCTCTTTTCCCTGGTCGTCCTCATCAGTA
ACAAACTGTTCCACAAGACGGTGAATCTGCAGAGCTCCCT
CAGCACCTCCGCGTCCACAGAGAAGCTGCCGTCTCCTCAC
GTGTCCCCGACCCGCCAGCGACCTTTACCCCCTCAGTGAC
CTCTTCAGGATTCACCTCTCGCTCTGAAAGGCGGGAAAAC
GATCCATTACGCACTCTCTGCATTTGAAAGCGTGAGTCTG
TGCTCTTCTGGACGAGTTGGTAATGTGAATCAAGGTCATG
ATTCTCGGTGTGATTTTAAATTTTTTTTTTTTCTCGGACT
GATTTTGTACCCATTACGTGCCATTTGGGTGATTTGTAGA
GACGGCACAAAGACCTCAGCGTGCACATTTTCTGTGAATT
GGCCCACCGTCCTCTTTTTAGGCCCTGTAGTCTACATTAG
TCGACTCTTTTTATCTGTTTATGGCCTTCTTTTTAATTTT
ATGTACTTTTTTGAGGCTCAGACACGCGAGAGAGTGTATT
TATCAATGAACACTAAACTCTATGAAGAAAAAAGTTCCTG
ATGGTTTACTTTCCTGCACTGACAACTGATCTAGAGTCAA
AAGGATCAATTTTAAAGCCCTCTTTGAGCAGTAGATGTTT
CTTGATATGAAAGTTATGAGTTATCGGTAACACTTTACAA
TATGGGGACACTTGGTTAATGTATGTTCTAACATACATGA
ATAAAGTTTGTACAGCATTTATTAGTTATAGTTCATGGTT
TACTAATGGGATTAGTTAGTAAAAGGGATAGTTCACTTAA
AAAATTTATTTACTCATGATTTACTCATCTTCAAGTGGTT
TAAAAACTTTTATGAGGTTCTTTCTTCCATTGAACACAAA
ATAAGATATTTAGAAGAATGTTAGAAACCTGTAACCATTG
ATAACTCACTCAAAAAATAAAAACTTACTTAATATTTACT
CATCCTCAAGTGGTTTAAAAACCCTCATTAGGTAGATTTT
TTTCTGTTGAACACGAAATAAGACACTTTAAAGAATGATA
GAAACCTGTAACCATTGACAGTGCACTCAAAAAATGTAAA
TTTACTCATCCTCAAGTGGTTTCAAATCTTTATAAGGTTC
TTTCTTCTGTTGAACACAAAATAAGATTTTTAAGCATGTT
AGAAACCTGTAACCATTGATAATTCATTTAAAATATGAAC
ATTTACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ei24-202 Contained in:
[Fosmid] CH1073-74N1 (1) (order this)

OTHER ei24-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046082 (1)
  • Ensembl_Trans:ENSDART00000153727 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC155239 (1) 2261 bp
    GenBank:BC092948 (1) 1894 bp
    GenBank:BC164145 (1) 1090 bp
    CITATIONS (2)