header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-619
Transcript Name: si:ch211-157b11.8-201
Previous Names: ch211-157b11.8-001, si:ch211-157b11.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055060 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055060|OTTDARG00000038432|ZDB-GENE-131127-436 si:ch211-157b11.8|OTTDARP00000043181 CH211-157B11.8-001 LG_ CR450814.4 Danio rerio protein_coding PUTATIVE, 2133 bp
CAAGGAGTGAAGAGGTTGAGCTAAACCCTGATTTTATCTT
AGTTTTTGAATGCGCCTGTATGACAGTGTGTGATTATTTG
TAGATTCGAGATGGATTTGATGGTGGAAAAACATGCCTTC
AGGTAGACGGTGAGTGTTTGTGTGTATAGGTATGAGTGTG
CGTTTGTGTGTGTTAGGGGGTGGGTGAACCGGTGCATGTC
AGACAGCAAAGAGCCACAGTTATCTAGGAATCTGAGCCAA
AAGAGCCTCACAAACAGACGGGAGCGCGCAGGAGAGCGAG
AGGGAGGGAAAGAGGAGAGAAGATCAAATAAAAGAGGACA
GTAGGACAGGAGACTCGCTGGAGGATAATCTGTAGGACCT
GATGACATAGCTACGAATCTGAAGAGAGAAACAACATCAG
TGATACAGGAGTTTTCAGGCAGTGTACAGGTGTCTCTATC
TCTCTGGACTCTTCTGGTGGCCTGAGCAGCATGTGTGTGC
GTGTCGTGCTGGTGTTTTTGCTGGGAGTGTATATGATGTG
TGTTCGTGTGTGGTGTCAGAGGGACATTCTGGTGGCCGGA
CCCCCAAACAGTGCAACGTCAGCCCCCAAAATACATCAGC
CACACTCTCAGGACTCGAGGCTCAGAAAGACTCCAGAGAA
CCGTAAACATGCACAGGTGACTGACACCTCTGAGCGGCTC
ATCCAGCTGCAGCGCTGTATGCTTCAACATGAATCAGTGG
CTATGAGTCGGGGAGATGGATCAGACTCACTGGTCGCCTT
TCTGGCTCTAATGGCAGCGGTGCTGACCGAATGTAACCTC
CACTGCCATAGTCAAAGACTCCGAGAGATGGCCACCAGAC
TCGAAAGTGTGGTGGGCAAAAACGGGGAGAAAGATTTGCT
GCTGTTACTGAAGAGTATCACACATTCTAAACCTAATAGC
CTCAAACCAAGGACTCCTACAGTGCCTCCATCTGCAGGGC
TTTACCCTCAAGACTGTCATGAAATCTACCAATTAGGAAT
CAAAGAGAACGGAATCTACACCATACAGCCTGATCCAAAG
CAGCCAGCGCTGGAGGCTGTGTGTGACATGGTTTCAGCTG
GAGGAGGATGGACGGTTTTCCAGCGCCGTTTTGATGGAAA
AACTGACTTTAACCGAACCTGGCAAGAGTACCGTGATGGA
TTTGGCTCCCCGCAGACAGAACACTGGCTAGGGAACGCAG
TTCTGTATGCATTAACAGCCAACGGGCAACACACACTCCG
CATCACTCTACAAGATTGGCACGAACAGACACGCCATGCT
AATTATAACAACTTTAAAGTGGCTGGAGAAAACCAGAGGT
TCCGTCTGACTGCTCGAGAGTACCACGGTGATGCTGGCAA
TGCATTCAGCTACAGCAAACAGTACAATCATGATGGCAGA
GCGTTCAGCACATATGACCGGGATCATGACCGCTACGCTG
CTGGTAACTGTGCCCGCTACTATGGTGCAGGCTGGTGGTT
TGATTCCTGTTTGGCTGCAAACCTCAATGGACGCTTCTAC
CATGGTCGTTACAGCGGCATCACAGACGGCATCTACTGGG
GCACCTGGTATATACTGACTGAGTATCGCACTGGGGAAAG
ATATTCATTTAAGAGTGTTGAAATGAAAACGAGACCCAGG
CGAAGCTAAGAAAAAAGTCTTTTTTAATGAGAATTTCTTG
ATATGTTATCAAACTCTTGCACTGCATTTCATCTCAATTG
ACATATTTTAAACAATCTTGTTTTTCTCAGAGTACACTAT
CCATTTTTAGTTACACCGTCTGAAAAAAAAAAAAACTGTG
GACTTTATCTACCATAAACTGTAAAGAGTGATAGAAGTAA
ACTGAGAGTAAACCCACTGTAACTCGGAACAGTTAAGTTG
ACCTAATTTTAATAATTATGCACATAGTTCATTTACTTAA
TCATTTAAAGGCAACAGGTTTACTCACTTTAATTTACTTT
AAAATCAATGGGTATACTCAATTTAAAAGTAAATTAAACT
AATAGCTTTTTACAGCGTAGATATACAGTACAGATGCCAC
ATTCAACCACATTAAACACTTACCCATTGAAGTGTCTAAT
GTGGTTGAATGTGGGACTATCTTGTAATGGTCAACGTCTT
TCACTTACAATAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-157b11.8-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055060 (1),  Ensembl_Trans:ENSDART00000085090 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE318299 (1) 862 bp
CITATIONS (2)