Transcript

si:ch211-81n22.1-201

ID
ZDB-TSCRIPT-131113-577
Name
si:ch211-81n22.1-201
Previous Names
  • ch211-81n22.1-001
  • si:ch211-81n22.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054897 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054897|OTTDARG00000038311|ZDB-GENE-131127-633 si:ch211-81n22.1|OTTDARP00000043061 CH211-81N22.1-001 LG_ BX470154.5 Danio rerio protein_coding PUTATIVE, 1082 bp
GTCAAACTCAGCAGGTCAAACTGTAAACACTAGGTGGCGA
TAACAGCAGCTCGGCACGACTGAGCCTCCTCAGAAAAGCA
GAGGAGTGAATGCTGGAAGTTCCTCATATTCATTCATCTG
TGTTCAGGATGTTTCTTTGCACGTTTAGGAACTCGAGTGC
AAATGATAATAAACTAGATCTGACGGAAACATCTGTGAAC
TTTGAACTGACAAACTGCTGACATTCCACAGCTGCCTCAT
GTGACCGAGTGCAGTTCAGTCAGACACGAACAGACCACAC
AGTGGATTAAGAAAACGACAATGACCAAATTAAACATGCA
CATCGTGATCCGCCACTATCAACCCTCCGACCGCGAGGCT
GTGGAAACAGTTTTCCGGGAGGCAATAGAAGAGCACATCA
ATCCCGCATTCATGTATGCTATGACCCGACCGCTGCACAT
CACCATAAGCCTCTTCATTTACGTCAGCGCTTACATACTA
AGCACATACTCCCTGGTTCTATCCTTGATGTGTGGAGGAT
CCTGGATAGGCCTGGTCTACTTCTGCTGCCATGAGTTTTA
TGCTGGATACGTCCGCTCCAGACTCAACACGGACATGAAG
GATATTTCTGCGTACTACCTCGAAAATCCTGACAACTGCT
TCTGGGTTGCAGAAGCTGAGATTGAAGGCCGGCCTCAGGT
TTTGGGTATGGTTGCTGTGGAGGGTAAAAAGGGGTCTGAA
AAGTATGGAGAGCTTTACAGGATGATTGTTTCATCCGCTT
GTCGCCGTACTGGACTTGGTGTAAAGTTGGCTCAGACTGC
TGAAGACTTCTGCAGGGAGCGCGGCTTCTCAAAGATCATG
CTTTCCACTTCTTCGACACAGAAAGCAGCCGTGGCGTTGT
ATTTCAAGCTGGGTTTTAAACTCCTCCGGGTTCACACTCA
GACTGAGAGCATGCAGTGGATGATCTGGATGACCAGAGCC
ACCATTCTGACCATGGAGAAGAAGATCTGATCTTTAAAAA
ACTTTTATAAGGAGTTTAAATAGTTTTTAATAATCATACT
TGATAAAAACAGTCTGCAGAAACACTTCTGCCTTTGTATG
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations