ZFIN ID: ZDB-TSCRIPT-131113-564
Transcript Name: dip2bb-201
Previous Names: dip2bb-001, ch73-187p21.2-001, si:ch73-187p21.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054851 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054851|OTTDARG00000038277|ZDB-GENE-100729-4 dip2bb|OTTDARP00000043028 CH73-187P21.2-001 LG_none CU467856.6,AL954729.6 Danio rerio protein_coding NOVEL, 5378 bp
ATGGCGGAGCGCGGTGTGGATGTGTCCGCTCTCCCGCAAG
AGGTCCGGGAGCAGCTCGCTGAACTGGACCTGGAGCTGTC
TGAGGGTGACATCACACAAAAGGGATACGAGAAGAAGAGG
GCAAAAGTTTTAGCGCCCTACTTGGCCCAAGCGCAAGATT
TGGCTCCGCCTCCAGCCTATGATGAGCAGTCTCCTGGTCC
AAGCTCCGCCTCTGCTCCTGAACCCGGCCCGTCAAACTCG
TCGTCCTCCTCTTCTCGTCATCGGCGCACTCGGAGACCAC
ACCGGAGCGGCGGCACTAGAGATGAGCGCTACCGATCAGA
TATCCACACGGAGGCAGTTCAGGCAGCGCTGGCCAAGCAT
AAAGAGGAAAAGATGGCACTGCCAATGCCAACTAAACGTC
GCTCCACATATGTGCAATCCCCAATTGACAACTGCACTCC
ACCAGACTCGTCCTCTTCGTCTGATGATGAGGCGGTGTCC
AGTGAAAGTGCAGGCCCTCAGCAGTCCTCAGACACTTGGA
TTAACAGCTCTCTGCACGGCTCTTCCACCTCCTCCTCTGC
CTCCTCTACGCTCTCACATGGCGAATCTCGACCCACCCAG
AACCCTCAGCCTCAGTCCCAGCAGCTGCCACCTCCACCCG
CTCCTGCCCACCCGCCACACTCACACTCGCAACCCTCCGC
CCTGGCAGAGGCCTTCGCCCAGACACGCATTGATCCAGTT
GGAGGAGTCGGGCCTCCTGAAGTGCCATCACAAGCCCAGG
CCAGAGGCTCTCGTGTGGATCTGCCGGCCAATGCTGTGGT
GCGAGGCATGAGTCGAGGACAGAGCCGCTCCAGCATGATG
GAGACAGCAGACGGTGTTCCAGTGTCCAGTCGTGTGTCCA
CTAAGATCCAGCAGCTTCTAAATACACTCAAACGACCCAA
ACGGCCACCGCTCAGTGAGTTCTTCATGGATGACCAAGAG
GAGATTGTGGAAGTTCCTCGGGCAGATCCGAACACCCCGA
GGCCCGAAGGCCGTCAGATCATCCCGGTGAAGGGTGAGCC
GCTGGGTGTGGTCAGTAACTGGCCTCCTGCCCTCCAGGCA
GCTTTAGCGCGATGGGGAGCCACACAGGGCAAGAGTCCTG
CTCTCACCGCTCTGGACATTACAGGAAAACCACTCTATAC
ACTCACGTTTGGGAAACTGTGGAGTCGCAGTGTAAAGCTG
GCCTACACGCTCCTCAACAAACTAGGCACCAAAAATGAGC
AGATCCTCAAACCAGGAGACAGAGTGGCGCTGGTGTATCC
TAACAGTGACCCCGGTATGTTTTGGGTTGCGTTTTATGGT
TGTTTGTTGGCTGAAGTTATTCCTGTCCCCATCGAGGTTC
CACTGTCCCGAAAGGATGCTGGGAGCAGCCAGGTTGGCTT
TTTGTTAGGCAGCTGTGGTGTGGGTCTGGCTTTGACCAGT
GAAATCTGCTTGAAGGGTTTACCAAAAACCCCCACTGGAG
AAATACTGCAGTTTAAAGGTTGGCCCAGATTAAAATGGGT
GGTGACCGACTCCAAATACCTCACAAAGCCTTCGAAAGAC
TGGCAGCCTCACATCCCAACAGCCAACACAGACACGGCAT
ACATTGAATATAAGGCCAGTAAGGAGGGCACAGTGATGGG
GGTTGCGGTTTCCAAAGTGGCCATGCTAACACACTGCCAG
GCGCTCAGTCAGGCCTGTAACTACTGTGAGGGTGAGACAC
TGGTGAATGTTTTGGACTTTAAGAAGGACATGGGATTGTG
GCATGGAGTTCTAACGAGTGTGATGAACCGAATCCACACA
ATCAGCGTTCCATATGCAGTAATGAAGGCCTGTCCTCTGT
CCTGGGTTCAGCGGGTTCATATACATAAAGCACGGGTGGC
CCTGGTGAAGTGCCGTGACCTGCATTGGGCGATGATGGCG
CACAGAGATCAGAGAGACACCAGTCTGGCCTCTCTGCGTA
TGCTAATTGTTGCTGACGGCGCCAATCCTTGGTCTGTTTC
ATCATGTGATGCATTTTTGAACGTATTCCAGGCTCACGGT
TTGAAGCCAGAAGTCATCTGTCCTTGTGCTACGTCACCTG
AGGCCATGACCGTCGCCATTCGCAGGCCTGGGATTTCTGG
TGCTCCTCTTCCAGCGAGAGCCGTTTTGTCCATGACTGGC
CTGAGTCACGGGGTCATCAGAGTCAACACTGAAGACAAGA
ACTCGGCTCTCACCGTTCAGGATGTGGGACATGTCATGCC
TGGAGCATTGATGTGTATTGTGAAACCCGATGGGCCGCCT
ATGCTGTGCAAGACGGATGAGATTGGAGAGATCGTGGTAA
ACTCTCGCGCTGGTGGAAACATGTATTATGGCCTTTCAGG
AGTTACTAAAAACACCTTTGAGGTGATCCCTGTCAACGCT
AGTGGTGCTCCTATTGGAGAAATCCCATTTGTACGGTCGG
GATTACTGGGATTTGTTGGACCGGGTAGTCTTATTTTTGT
GGTGGGTAAGAATGAGGGCCTGCTGATGGTCAGTGGTCGT
CGTCACAATGCTGATGATCTAGTGGCGACGGCGCTTGCTG
TGGAACCTGTCAAAACTGTGTACAGAGGCAGGATTGCTGT
GTTCTCGGTGACTGTGTTCTTTGATGAGAGGATAGTAATC
GTAGCAGAGCAGAGGCCTGATGCTAGTGAAGAAGACAGTT
TCCAGTGGATGAGTCGGGTTTTGCAGGCAATTGATAGTAT
TCATCAGGTGGGTCTGTACTGTCTAGCACTGGTTCCTGCA
AACACTCTGCCTAAAACTCCCCTGGGTGGCATTCACATCT
CAGACACCAAACAGCTGTTCCTAGAGGGGGCACTACATCC
CTGCAACATTCTCATGTGCCCACACACCTGCGTCACCAAC
ATGCCCAAACCACGCCAGAAACAACCAGTGGGAGTCGGGC
CTGCCTCCATCATGGTGGGTAATTTGGTTGCTGGGAAAAG
AATAGCACAGGCTGCAGGGAGAGATCTGGGACTCATTGAG
GACCAAGACCTGGTCAGGAAGCTGTGCATGTGGCCTACTA
TGATGCATCAGTTCCTCACTGAAGCTTTACAGTGGAGAGC
TCAAACAGATCCCGACCATACGCTTTATGTGCTTTTGAAT
GCAAAGGGAGTGGCGGTGTGTACAGCTACATGTGTGCAGC
TTCATAAAAGAGCAGAGAAAATCGCTGCTGCTCTCATGGA
GAGAAGTGGCATTAACATCGGAGAAAATGTGGTGCTTTTG
TATCCTCCAGGTATTGATCTGATCGCAGCATTTTATGGCT
GTTTGTACGCTGGTTGTATTCCTGTCACCGTGAGGCCTCC
ACACCCACAGAACCTCTCTGCCACTCTGCCCACCGTCCGC
ATGATCATCGATGTCAGCAAGGCTGCTTGCATCCTCACTA
CTCAGGTTCTAACAAAGATTCTCAGATCGAAAGAAGCAGC
AGCTACAGTCAACATAAAAACATGGCCTATCATTATAGAC
ACAGATGACTTGCCTCGCAAACGGCCTCCCACAATCTACA
AGCCACCCAATGCTGAGATGATCGCCTATCTGGACTTCAG
TGTTTCTACCACAGGCATGCTGACAGGAGTAAAGATCTCT
CACGCTGCGGTCAGTGCTCTGTGCCGCTCTATAAAGCTGC
AGTGTGAGCTCTACTCCTCTCGCCAGATCGCCATCTGCCT
TGACCCCTACTGCGGACTTGGTTTTGTGCTCTGGTGCCTT
GCAAGTGTCTACTCTGGTCATCAGTCCATCCTGATCCCCC
CTATGGAGCTGGAAACGTCACTGACCCTGTGGCTGGGAAC
ACTCAGTCAGTACCGCATCAGAGACACCTTCTGCTCCTAT
TCTGTCATGGAGCTTTGCACCAAGGGTCTGGGCGGACAGA
CAGAGCTGCTGAAGGCGCGTGGTGTGAACCTGTCGTGTGT
GAGGAGCTGTGTGGTGATCGCTGAGGAGCGACCACGTTTG
GCTCTCACACACTCCTTCTCCAAACTCTTCAAAGATATTG
GACTCTCCATGCGGGCTGTCAGCACTGCTTTTGGGTCGAG
AGTTAACCTGGCTATCTGCCTACAGGGTACTACAGGACCA
GACCCCTCAACTGTGTATGTGGACATGAAGTCTCTCCGAC
ACGACCGGGTGAGGTTAGTAGAGCGAGGAGCACCACAGTC
GCTTCCACTCATGGAGTCTGGAACAATTCTTCCAGGTGTG
AGGGTGGTCATAGTCAATCCAGAAACTAGAGGACCGCTAG
GGGACTCTCACCTGGGGGAGATTTGGGTGAACAGTCCTCA
TAATGCAACAGGATACTACACAATATATGGGGAGGAAAAT
CTGCAGGCTGACCACTTCAACACTAAACTGAGCTTTGGAG
ATCCTCAGACGCTCTGGGCCAGGACTGGATACCTGGGCTT
TGTCAAGAGAACTGAACTCACAGATGCCAGTGGAGATCGC
CATGATGCTCTGTTTGTGGTGGGCTATCTGGACGAGACTT
TAGAACTGAGAGGTCTGCGATATCATCCAATTGACATCGA
GACCAGTGTGTCTCGTGCCCACCGCAGCATTGGTGAAAGT
GCCGTTTTCACCTGGACAAATCTGCTGGTGGTGGTGGCTG
AGCTCTGTGGATCAGAGCAGGACGCTTTAGACCTGGTTCC
ACTGGTAACCAATGTAGTATTAGAGGAGCACCATCTGATT
GTGGGAGTAGTGGTTATTGTGGACCCAGGCGTCATACCTA
TAAACTCCAGAGGAGAAAAGCAGCGAATGCACTTGAGAGA
CTCTTTCCTGGCAGATCAGCTGGACCCCATATATGTGGCG
TACAACATGTGAGCTGCTTTATGGGTGAGCCAACAGTCTA
CCAGAGAGGTGCTATGGAGCCTGACCTCAGAACATGGGAT
TGGGTTCATTAACAGACAGACTCAGCCCTGCTTTTTTAGG
GGATAAAGTGTTATTTAACTGAAATATAAACACGTGAGAT
GACTGTTTTTGGAGAAGGAATAGTTTAAAATAATTGCTTA
TTTCCTTCCCTCCTAGATCCTCCCCCTTTTTTAAGCAAAA
TGCCACATACTTGATGTCCAGCTCTTGGTCATGATCTCAA
CTTACTTGAAGTACATAGCAGTTTTTTTCTCTTCTTTAAC
ACCCTTCTGTTTTAGCACAGTCTAGTACTATTATTAATTC
AAATGAGCTTAAAGCCTCAGTTCGTAAGTTTTAACCTGGG
TTGTTTTGATTTCAGAGTTTCTGAAGTTTCTTTTAAACAA
TTCCAAAATCAATTCTGGTTCAGACTACGCAGCATATGTC
TAAATTGGCACATTTGTTGAGCTATTTCAACAGTGCATCT
TTATGAGTATAACTGAAGTCAGTCGCTACACTTTAAAAAA
AAATTGTCCTGTTTCTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dip2bb-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000054851 (1),  Ensembl_Trans:ENSDART00000044276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC068015 (1) 6276 nt
GenBank:CT651226 (1) 829 nt
CITATIONS (2)