ZFIN ID: ZDB-TSCRIPT-131113-560
Transcript Name: ccndbp1-201
Previous Names: ccndbp1-001, ch1073-127n10.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054833 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054833|OTTDARG00000038267|ZDB-GENE-070410-17 ccndbp1|OTTDARP00000043018 CH1073-127N10.3-001 LG_ CU855794.4 Danio rerio protein_coding NOVEL, 2434 bp
CTCAGACAATATTAGTTCCGCTTGACTTTCGTTCCGCGGC
TCCACGAGACTGAAGCAAAGCGCGTCATGAGCGCCGAAAA
CTCGCGTTCAGAAGCGCTGCTTCCGCTGAGAAACCTCTGG
AACTCGGTGAAGTGCAGCAGGGATCGAGTGAGAGATGGAG
AGTCCAACGACAGCAGCGGCACCTTCAGCTTGGCCAACTT
CTGGGAGATTCTGAATGAAGCTGTAAAAGCAGTGTCTCAA
GAAGCGACTAAACTCAGCCTGATGTTCTCCAAGCCGCCAC
TGCCGTCAGACGAGGATTGTGCAAAAATGGGGGAGTGTGT
GCAGAAGAGTGTGTTGACCTTGTGCACCGTTTACTTCTGG
CTGCCAAAGAGTCAAGGAGTCACACTGAGGAGGTCTGTCA
GGGACGCCACCGCTGAGGTTCTGGAGGGTCTGGTTCAGCT
GCTGGATGTCATTCTGTCCTCACCTGGACAAAGTCTCTCG
CAGGAGCAGCTCACCTCCACCGGGAGTGTTTGGGCCGCAT
GTGACCATTTTGACCAGATACCCAAAGATAACCGCAGTGC
TGTTCTGGCCGTCTTGAGCTCGTGTGTGGGTTTGGTGAAG
GACGCTCTGGAGGAGATGCAGCAGGCTCTGGCTGAGTCAC
AGGACCCGTTTGGAGACGTCCTGGATGATGATGATGATGA
TGAAGGTGGTCGTGGGAATCAGGACAGGTATTGGTCAGCG
TCAGACCGGCAGCTGATTGGTCAGTGTGAGGGTCTGCTGA
AGGCATCTGCAGCCAGTCTGCGCAAACTCTCGTCTGCGGT
CAGACACAACGCTCAGCTGGAGACGGAGCAGGAGATCGCT
CAGCTGGACGACCTGGCGGACGCTGCAGCACATGTCAGTC
CCTGTGTTGATGACCTGGCCCTTAGCCTTTACCCGCCTGT
GGACCGAGCTGCCGTGGAGCAGAACGTGTGCAGACTGGCA
GCTGTGCTGAAAAAACTGCTGGACATCACCAGGTCCTCTC
ATGTCTGTGCGGAGGCCGATGTGTCCTGGGTGGAGTTTCT
GAGTGGAGCTGTTGAACACAACCTGGAGAAGGTCAGATCA
CTGCTGAGGAGCGGCTCGTAGCGCACGGAGAGACGGTGTG
TGTGTGTGTGTGTGTGTACAGGTTTAGCTACTCTTGTGAG
GACTTGTATGTTTTCATGTATATAGTGAAATATTAAAAGG
ATCCATTATTGAGGATATTTTACTGCTTGTAAAATTCTCA
GCAGATGTTCATCAGTGTGTGCAGTTGTGTGTGTGAGGGT
TGGGTTAGGGGTAGAGTTATGGTTAAGCCATAGACATCAT
TAACCTGAGAGAAAAACAATGGAAGTCTAATCTAATGTCC
TCACTAAGATGAAACAAACCTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTACTT
ATTTTTATATCCTGCTGGGGACTTAAACCTGAATGCACAC
AGATTCATGGGGACTTGTATCACAGGGAGGATCAATATTG
AGGTCTTCATGGGTAAACAAGCTCATAAATCGGTCAGAAT
GAAGGATTGTAAAGATGTAAACGTGCAGAGTGTTTGCGTT
GAGGGTTAAGTTTTAAGAATAAACAGTCCGCACAGTAGAA
ACATCACTACAGGTATGGAGAGTCCCCACTTGGATATCGG
AACAAGTGTGTGTGTGCGTGCATGCATGTGTGCGTGAAGT
ATCCAGAGCTTTTACTGCAGAGGAGAATCAACAACAGCAC
AAACAAACTGAGCTTGATCTGCAGCCGTGGAGGAGTCTGA
GCCTCAGAAATATTGACATGTGTTTTCATGCTTTTATTCA
CAATATCTTCTGTTTATCTTCTGCTCATTCTGTAATGTTC
GTCATATTACAGATATTAATATTACATATGACTTGCTTCA
TTAACAGAACAAAACAGACTTTTAATTCAAATGTTTATTT
ATTCTGATTAAACGCATAATGCTAATGCTCCAACGAGTGC
TTAAAATCCTTGAGAGTTGGAGAATTAAAAATAAAGATTG
AACACACAAAAACATGAAAACATTACAAAACCCTAGAGTT
GTTCTGAAAATAAAGACACACAGATAAAAACCTGAAAAGT
GCTTGAATTAATTTTGTGCAAGAAGTTTTGGTGGAAAAAA
AAGATCCCACATTATTTTCTATTTATTATACAGTTCATCT
CCAGGTGAACATTCTGTTGTTTCTACTATGAAAGTCAATG
ATGAGTTTGTTTTGTGTTCAACAGAAAATCTCTGATACTT
TGTGAATGAAATAAATATACAAACTGCAAAGCCCTAGAAG
TTTTCTGCAAATAAAGACACAAAGATAAAGATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccndbp1-201 Contained in:
[Fosmid] CH1073-127N10 (1) (order this)
OTHER ccndbp1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054833 (1)
  • Ensembl_Trans:ENSDART00000057466 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC093146 (1) 2359bp
    GenBank:BC133859 (1) 1240bp
    GenBank:EF581817 (1) 1210bp
    GenBank:EG581043 (1) 927bp
    GenBank:EG575373 (1) 916bp
    GenBank:EG573511 (1) 911bp
    CITATIONS (2)