ZFIN ID: ZDB-TSCRIPT-131113-541
Transcript Name: sgip1a-201
Previous Names: sgip1a-001, dkey-218b7.7-001, si:dkey-218b7.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054678 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054678|OTTDARG00000038161|ZDB-GENE-131121-25 sgip1a|OTTDARP00000042925 DKEY-218B7.7-001 LG_none BX088595.7,CT574590.12,BX957307.12 Danio rerio protein_coding NOVEL, 9258 bp
TTCCTCTTTCGTTTGCCATAGTCATATAAACAACGTTGAT
TCAACTCTCTTAATATAATCTATAACTGTGATAACGCTAA
CGTTACTACTCTAAGCAAATTGAGTCGGATCTGCAGGTTC
TGCGCCTCGACGAAAGCTGGAGTTTTTCTGTGAATGTTTG
CAGTGGGAAAGTTTGTTTATGTTGTGAAGGGCAGGTCCAC
ACAGCCAGGCGCGTGTTTTTGGGACAGTGCGAGAAGCAGG
AACCCGAGGAAATGTGGTAATACATCAGCAGGTGAAGAGG
GGAATTGGTGCTGGATAAGCCGGTTTATTCTGTTTACATG
CGGGTTTACCTAATGACAGAAACAGCATGATTCCTTCAGT
TCGACTTCTGATTTCAAGAAAGTCACGGAGCAGCACGCTG
CACCATAACAAGCATCCTTTGGTGATCGTGTAGACCGCAG
CCGCAGTGGGCAGCAGCAGCAGCATCCATGGCCTAAACAC
GGAGCCCTAAAACATCTGACGGCCCGTCGTACGAGGCACA
CGGGGACTTTAAACCCGAGGGTTTTGGAGGCCGGAAGACT
GTTTTTATTTGGTTTCGTTTTTTAACATCTCTCCATCTGG
TAACCAGGGGCTTCTCTCCTCCCCTCCTCCCATTTCAGGC
TCCTTGGAGATAGAGGAATGCAAATCTGCAATCATGATGG
AAGGATTGAAAAAACGCACCAGGAAGGCCTTCGGGATACG
GAAGAAAGAAAAGGACACTGACTCTACGGGGTCACCAGAC
AGAGATGGTGGACCACAGAAAAAGACCAACGGGGCTCCAA
ATGGCTTCTACGGGGAGATTGACTGGGACAGATATAACTC
GCCTGAATTAGACGAAGAAGGATACAGCATCAGGCCAGAG
GAGGAAGAGGGAGCAGTCTCCAAAGAGAAGACTCACTTTT
TCTCGTCCAGCGAGTCTGAAGAAGAGGAGGATCACCGCAA
AAAGTTTAAGATCAAAATCAAACCCCTGCCAGCAGACGCT
AGCTTTGCGGCTCCCTCGGTAGATGAATTAAAAGCCTCCA
TAGGCAACATAGCTCTGTCTCCCTCGCCTCTGAGACGTAG
TCCGGGGCTGGCAAAAAGAAATCCCTGTGATGAAATTGCG
CGGCCGAGGCGTGCTGTTCCAGCACCTGCACCAGTTTCTG
CCCCTTCCCCAACACCTGCACCCGTGGTCCTTCCAGAGCC
TGCTAGTAATAAGAAATCTCCAGTGCCAGAGGATACAACA
GCCTTATTCGGCCCTCCGCTGGAAACAGCCTTTGATGAGC
AGAAGACCAGTGAAGCTCTGCCTCCGCTTCCGCCTAAGAA
TGTGCCGACCTCCCCCCCACCGATTGAATCTCCTACTACA
GAACCTGCTGATGTTCAGAAGGAAGGGAATTCAAGACAAA
CTTCACAGAGGCCCTCTATAGCTGATTTGGACAACATCTT
TGGTCCAGAAAACTCTCCTAAACTTAGTCAAGATATTGAA
GACACGTGGGTCTGCTTCAACGACGAGTCACCTGAAAGAC
ATTCTCCTCCTTTGGAGGGAGAGCCAGCACTCCAATCATC
TCCACCACCCCCAGCAGAACCAGCTCCCCCTCTACCTAAA
TCTCCTCCTCCACTGGATGAACCAACCCCCCCTTTACCAA
AATCTCCACCTCTTCCTTCAGAACCTGCACCCTCTCCACC
TGCCTGTGAGCCACTAAGGGAAAGCCCCCCACCTGTTCTC
AAAGACAAAACTCCTTCTCCTCCAACTGTCCCACCTCCTC
CAATTGAAGAGGCCCCACTCCCACCAACACCAGATGATGT
TTTTCACACCACCACAGACTTTTCACCCTGTGCTCCTCTG
ACAGAGACCCAATCAAACACAACCAACAGCCCACCAAACA
TTGTAGAGACAAGTGCACGTACAATCCCTTCACCCTTGGT
TTTGAACCAAGAGGAGGTAAAGAGCCCTGATGAAACCCCA
TCAAAAGAGGACCCAAGTGAGAGCAGCACTTCACCCAAAG
AGACTGGTCAAGGAGCACGTTCTACACCTCCTCCTCCTCC
ACCTCCCACATACAGGGCAGTAGTGTCCTCTCCAGGACCA
GTCCCTCCAGCTTCTGCTAGTGGAAATGAAAGTGGCTCCT
CCTCCCCTGCACGTCCCTCAACGCCACTGGCTACCAGCAG
CTCCCCCCCTCCCCCTCCCCCACCTCGGCCACCCTCGCGA
CCCAAACTGCCTCCTGGGAAACCAAGCATAGGGGACGTGA
ATCGGCCGTTCAGCCCCCCTGTTCACTCGTCAAGCCCCCC
TCCTTTGGCACCGCTGGCCCGAGCGGAGAGCACTTCTTCT
ATCTCCTCCACCAACTCTCTGAGTGCTGCCACTACACCCA
CCGTTGGTAAAGAGCTCTCCGTGTCTGTGTCAGAAGATGA
CGCTTTTGTAGACAAACTTCCCAGCTTTGAGAGACGGGCT
GATATTCCAGCAGGCTGTTCTCGAGGGCCCAGTCCCCTCA
CCATGGGGGCCCAGGACACCCTGCCTGTGGCTGCAGCTTT
CACAGAGACTGTCAGTGCCTACTTTAAAGGAGCTGACCCT
AATAAGTGTGTGGTGAAGATCACTGGAGAGATGGTGTTGT
CCTTCCCAGCAGGCATCACTCGGCATTTTGCAAATAACCC
TTCGCCCGCTGTGCTAACCTTCAGCATAACCAACTACAGT
CGTCTGGAACACGTCCTTCCTAACCCACAGTTACTCTGCT
GTGACTCCACTCAGCCCAATCCAAACTCAAAGGAGTTCTG
GGTGAACATGCCAAACCTGATGACCCATTTAAAGAAGGTG
GCGGAGCAGAAACCACAGGCAACGTACTACAATGTAGATA
TGCTAAAGTATCAGGTCTTACCCAAGGGTCCTCAGTCCAC
TCCTCTAAATCTAGCTGTGAGCTGGAGATGTGAACCCACA
AGCACTGACCTGAGGATAGACTACAAATACAACGGCGGGG
CCATGACCACTCCTGTGGCCCTTAACAATGTCCAGTTCCT
CATCCCTGTGGATGGAGGAGTCAGCAAACTGCAAGCTGTG
CTTCCCCCGGGTGCCTGGAATTCAGAACAGCAGAGAATTT
TATGGAAAATTCCAGATATTTCACAGAAGTCTGAGAATGG
AGGTGTGGGCTCTCTGCTGGCCCGTTTCCAGCTGACAGAG
GGTCCCAGTAAACCGGCCCCAGTGGCAGTGCAGTTCACCA
GTGAGGGCAGCACTCTGTCTGGCTGTGACATTGAGCTAGT
TGGCCTTGGCTACCGTTTTTCTCTCATCAAGAAGAGGTTT
GCAGCAGGAAAATACATGGCAGACAACTAAACACCACCTC
TGACCCATGCAAGTCTGCACATTTGGACCAATTCTGAATC
TTTAAACACAGGACAGATGTGAAGCCTGACCCCTACCTGA
CCTTATATGGATGAACCTTTGTAGATGTGCGATACAGGTG
GATCCTCACACACTCCAGCAGTATTATATGAGTTGCATTC
TAAATGATAAAATGTGGACCGTTTTAGGGTGTACTTCTTA
TATTCGTAAACTGTATTCACTTTGCAACATCCGTATTACG
GCCTGGGTTTGTTCGTAAGGTTTTAGCCTCTTCTTTCTGT
CCGACGTGTTATTGGCTGTGCCTACCTGAACCTGAATTCT
CTCTACAAGTGATACTAAACGTGCTGTTTTTCTTACTCTA
TGCATTCAGTTTGTCAAAAGTATCACCTTTTCGAACAAGG
TAGCAAATTAGTACAACAGACTGACTGACTGTCTAAAAGA
GGAATGAGCCTTGGCCACAAGATGGCGCTATACTGTTGCA
TGTAGTTTGAGATCTGCGCCGGGTTTTGGTGTTGCTCATG
CACATCTAGTCATGAAAATGTATTCAGGAATATCGCATTT
TAATTCACTCAGTGCAGTCAGGTGCGTTAATTGGAGAAAA
AAATTATAGAAATTATATTTTGTTGAAACTCTTGGAATTT
TTAGACAGCCACTGCTTTAAAAAGAAAAATCTCCGGCTTG
CAATAGACACAGACTTAATTTTCCTCAACAGAAAAATCAA
TATAAATATATATAAATACATATATCTTGAAGGCCGTTTG
GTGTTTCTCGTATTGTTAAATAGCCTTTCCGTTGTTCCCG
AGGGAGCAGTGCTAGACATCAGAGTACATGACATCATTCT
ATTTTTATTTATTTAATAATTTGTTGTACATATATATAAA
CAAAAAAAGAAACCAGTTAAATTGTATATGAATAGACTTT
GAATGGTATCATACTTTAGGAGTTTTTGTTATCTGTGTAG
TTGGGTAAGCTGTGTACAGTATAATGCCGAGGTATAATTT
TTAAATTTATTTCAGATATAATTTTTTTAAAAACTCAAGC
GCAACAGAAAATATAGGGTATATATTGGGTCGAGGGGTGA
CGTTTGAAAGAGAGAAGGATGCTGTATCTACCTAAACGCG
TCATGCTTAATGTTTTGACAGTGTTAATGTACAGCGGCAC
TATTAGTTGAGCTTTTGGACATTGTAAATTGTTTTCTCAT
TCATGCAGATGTGTTTGTATATTCAGCCTCACGTTTAAAA
AAAAAAAAAAAACAACTTCAGTGTCCTGAGCATGAGCCCT
GCGCTTGAGAACATCTTTATTTTGCAAACGGTAACGGTCT
CTGTGAGATGACAAGGTTCTTGAGTGGTTCAATGACCAAA
TCGCTTTTTTTTTTTCTTTCTTTATTTTTGTTTGTACGTG
TATCTCCAGAATTGTCCTTTAAGAGAAAATAAGCTGCATA
TTTTTTAAATGTTTAAACCTATGAATAAAGTGAAAACTAT
TGTTTCTTGTGGAAAAAAAAAACTGTTTAACTTACCAGGT
GTTCAGAAGTTCACTGTCAAGAACAAACATTTCGGTTCCA
TCCCTTTTAGTGTCTAGTGATGATTTTGGTTTGGTTTGAT
GTTGGATTGATATTTGCAAGTTTAGGGACCGCCTCTAAAG
CTACAAACACAGAATATGCCAGAATTTAAAGCTCAAATGT
ATTTGAAGAGAATGACTTAAGGCAACACTTCAAAGGAAAT
CGATTAATAAGTTGATATGAAGTCATTTAAAAAAAAAAAT
CGAAGTTTGTTTTGAGATTTTTACACAAGTTTGAAAGCAA
TCTTTTGGGAAGAGTTCGGTTTTGGCTCCTAAACACCTTT
AATAGCTGGGACACACCAATCAAATGCCAAACAGCTAGCA
AAAAACAAAACCAAAAAGCTCCCTGTGAACACACCAAATG
GACGAAAGCTGACTGAAACAATAGCTGCGTTCTGCACATG
CACAGGGGCAATATTTTTTGTTTTCTGTTTGCTCGTTCGA
CAAAAAGGGACCGAATTCCAACACGCCAAGACAAAGTATT
AATCAAACAGCATTTAGTACCATAATCAATCACAGTAATT
GTAATTCACCACGGAGAGATTTCCTCCTGCAAATTTGTCT
GTTAACCTACACTCGTAGTGTTAAAGGTACAAAATCTGTC
ACTGGGGTGATTTCTTTTCTAAATACAGGTAGATAGTACC
TTTAGGGTACACTTTTGAATCTTTAGGGTTCCCTTTTAAG
TTAATGTAACGCACACATTTGTATTTTTTAGGTATTAATA
TGTACCTTTAAGTATCTGTTAGGAACAAAAATGTACCTTT
TGAAAAGGTACAGTCCCAGTGACAGATTTTGTACTTTTAT
TTCTAAGCGTTTAATAATCCATATTGTTTGCAAATATTAG
AGAAATGTTGTGAAATTACAGCTAGCCTCCTTGTGTTTCT
TCTTGACTTGAATTGTTTACTTGAAAGTCAGAGGTCCGAT
GCCGATTCATGATGCTGAATTTGGCCAATGTGATTCGATG
TTCACCCGACGAGAACCGATGAGGGGGGCACACCAAACAA
TTAGCCTGATCAACAAAACAATAAAGCCCCACAGCCAGTT
GTTGGCTTGGTGTATCCTGGCTTTAAGTTACCATTGGTTC
GTGGTTATTACACAATGGGTGGGTGTATGCTCTGTGATCA
CATCAAAGAAGTACCACCTGCAGTGCTGGGGTGTTGGAAT
GTTTTAAAAAAAAGGCAGAGCGACTCTAAAATGATTTCAA
ACTTTTTTTATCCCTCAAACAAAGAATTTTAATTAAAATA
GCTTAGTTTGAAGTATACCAGGTCTTTAAAGTCCTAAATC
CAAATTTAAGCGTTAATGTAGTTGTCTGATATAATGAATA
CCCTTCAGATTTTTTATATTTATTCAAATTAACTCAAGGG
TGGCGCAGTAAGTAGTGCTGTCGCCTCACAGCAAGAAGGT
CGCTGGTTCGAGCCTCGGCTTGGTCAGTTGGTGTTTCTGT
ATGGAGTTTGCATGTTCTCCTCGTGTTGACGTGGGTTTCC
CTTGGGTGCTCCGGTTTCCCACACAGTCCAGAGACATGCA
GTAAAGGTGAATTGGGTAGGCTAAATTGTCCATAGTGTAT
GAGTGTGTATGGATGTTTCCCAGAGATGGGTTGCAGCTGG
AAGGGCATCCGCTACGTAAAACATATGCTGGATAAGTTGG
CGGTTCATTCCGCTGTGGCGACCCCAGATTAAAAAAGGGA
CTGAACCGATTAACTCAAATTATATGTTGTTCTTTACTAC
CAAATGGGTAAACAAAATGTGCTGTAATTTACAGATTATT
AGCATTTGAAGATAATGACTTATTCAATATTAAGACTATA
AAGTGTTCATCTAGTGTAGGTCTACCTTGTAGTTTTGATA
TCCTGTACTTTAAAACAATATTCACAGCCACATACGCTTG
TACACAAAATATATCTTTATTTAAAGGGACAGTTCACAAG
AATAGACATTCACCAGTTTCTCTCTTCTGTTGAACACAAA
GATATTTTTAACACTAAACTTGTGAAGCTTTGGATACACT
TGAAGTTCAGTAATTTATAAGTAAATGTTTTATTTGTGAG
TGAACTATCCCTTTAAAACTCAATAATATTATACAGCAAT
TATATATCTATATGATTTGATAGTTTACTTGAATGAATAT
AATAAGTATAAAAGTTGTTCACATTACAGCTGACACTTTT
TAGATTTATGACTAAGGGCGTACCCACACTATGTACAGTT
AACTTGAACCGGATCGAAGCATGCTTGTCCCCCCCATCTC
CCCCGACGGCCCGCACTCACAATACATTTGGGCCTGGGCA
CGATTACATCATCGATGCTGCGCTGTTCAGTAAGCGCTCT
CGCTCAGCTCAGTGGTGATTGCTTTAATTATATCGTTTAA
GTCATTTGAAATCCTGTGACACGCAGTCAAATATTTTGCC
GAACAGATCAGCTACTTTTGATGCTCATAAACAACCATAA
AGTCCTCGTGCTACAGGAATTGGAAGGTTTGCTGAAGGTG
CAGCTGTCGTGCAGTGAGAGGTTTGCGTCTTTAATAAACT
ATAACAGTTTGTGTTCACTGAACTGGAATGATTAATAAAT
CTATGAAACAGTCCCTAAAAAGTCTTGTCTAGCTTTCAGT
TTCGGGCTTAGGCGCGTTTTGCACTCACACACAAGCAAAC
CGCGCCCAAGTGAACCGTGCGCAGGCACACCTCTTCCAAC
CGGGCCAGGGTCGGCCAAGTGAACCGTGCCTGAGCCCTAT
TCAAAGCACTCACACTTCTCAAATGATCCGGGAAACTTGC
CTGGACACGGTTCGGATAGCATAGTGTGAGTAGGCCCTGA
GTGTTATTTAGCTTTAAATTGCAGCATATTATATTTCTAC
GCTGTAAAAAATGATTGCTTAAATTTAAAAAAAAGTGAGT
AAATACATTGCCTTAAAAGTGACAAGTTGAATTCACTTAA
AAAGTGACTAAACCCCTTATAACCTGGAACTGTTTTAGTT
TGATTCAACTTATTTTTTATAATCATGCACTTAGTTAATT
TACTTAAAAATTTTTTAGTAGACTTAGTTTAAGTAAAGTC
AAGTAATCGTTTTAAAAGCAACAGGCTTACTCACTTATTT
TAAGTATAATCAACTTATTGTTTCTAAAGCAACAGGTTTA
CTCATCCTAAAGTCAACTAATCGTTTAAAAAAGCAACAAG
TTTACTCATTCTAAAGTCAACTAATCGTTTTAAAAGCAAC
AGGTTTACTCATCCTAAAGTCAACTAATCGTTTAAAAAAG
CAACACGTTTACTCATTCTAAAGTCAACTAATCGTTTTAA
AAGCAACAGGTTTACTCATCCTAAAGTCAACTAATCGTTT
AAAAAAGCAACAAGTTTACTCATTCTAAAGTCAACTTATC
GTTTTAAAAGCAACAGGTTTACTCACTAAAAGTAAAGCCA
ACTAATTATTTTTAAAGTAACAGCTTTACTCACTCATTTT
AAGTAAAGTCAACTAATTGTTTTCAAAAGCAACAGGTTTA
CTAACTTATCCTAAGTAAAGTCAACTTGTTGTTTAAAAGC
AACCGGTTTACTCACTTATTTTAAGTAAAGTAAACTAATC
GTTTTAAAAGCAACAGGCTTGCTCACTCATTTTAAGTAAA
CTTATTGTTTCAAAAGCAACAGGTTTACTCACTTATTTTA
AGTAAAGTAAACTTTTTGTTTCAAAAGCAATAGGTTTAAT
CACTAATTTTAATTAAAGTCAACTTATTGTTTCAAAAGCA
ACAGATTTACTCACTCATTTTAAGTAAAGTCAACTTATAG
TTTTTAAAGCAATTGGATTTACTCACTAATTTTAAGTAAA
GTCAACTAATAATTTTTTACAGTGTATAATTTTAGAGATG
GTCACAGAATTTGCAGATATTAAGCATCAAACCAACTTTA
TGCCAGTGCGATGTTTGAAGAAGAAAACTGTTTTTTTATG
TTTCCATCCACATTCAGCGGCATCTGTTAAACCCTGCATT
GAATATTTTCTGAGCACTGTAACTAAAGGGGTTTTTTATT
GCACTGAGATTAACTGAAGAACAAATCAAGAGTTTCGCAG
TTGAAAGAAAAAGGAAAAAAAACAGCTATGAACTGAATTG
TGTGTGTAGTGCTTTATCAGTATGTCTACATGGTGAAACG
TCACTCAGATGCGCAACAGAAGCGAGAAAACTCATGTCAG
TGTAGATGTACGTGGAGCTGTGTGTGAATGTAGTATGTGT
GTGATGCGTGGGAGGGAATGCGTGTGTGAGAGTGTGTGTT
TGCTGTCTGGTAACTGTAAATCATCTCTTCCCAGCAACAT
GTGCAAGCTGTGTTTGTACAAAAAAAAAATGTTAACAAAG
ATTTGAAATATTGAGATTACCTTGCTCTTTCCAAAACAAT
AAAACATAAGCCTGATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sgip1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000054678 (1),  Ensembl_Trans:ENSDART00000154228 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH433891 (1) 768 nt
GenBank:BG884298 (1) 402 nt
GenBank:CD588014 (1) 316 nt
CITATIONS (2)