Transcript

zgc:161969-201

ID
ZDB-TSCRIPT-131113-505
Name
zgc:161969-201
Previous Names
  • ch211-194e2.4-001
  • zgc:161969-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054391 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054391|OTTDARG00000037986|ZDB-GENE-030131-2597 zgc:161969|OTTDARP00000042724 CH211-194E2.4-001 LG_none CR854926.5,CU683898.8 Danio rerio protein_coding KNOWN, 2501 bp
GGAAATGCGCCTCTGTTGTTTGGTAGTAACGGACTACTCG
ATATTTGGATTACGTAATTAGATTACAAAAATCTAGAGTC
TGCATCTGGAATAGGATATATTCTATTTATTTATTTATTA
CACTATTAAATAGTACTAAGCGAACGCAATTTACTGTGTT
TGTTCCTACGTTTTTAAAGCGCTGTCCAGACCGGAGCCTC
GTGTGAAGATGGAGAGATCTCGTACAGCTTTTGACCACTG
GATGCACAAACACTACTTCACGTACAGGGATACAAGAGGA
AGAAACATTACTGTTCAGTGCAACCTCTGCCTCCCGAAGA
TCAACATCTTGTCCACCGCAAGGGACTCCACGTCTAATCT
GAAGAAGCATTTAGAGAGAAAACATGCAGTGCCGTGTAGG
AAAAGATTAAGGGAAGCAGCAGGCATCGATGGATCAAGTT
CATTTGCAACAAACATTTTGGAAAATCAAACGGAAGAATC
ATCGGAAGCAAAAGATGATAAGAACGACTCCACCATTTAT
TATCAAACATCACAATCCAGGCTAAATGCCTTGGTTTTTA
ATTTTATCGTGGAGGATGTGCAACCCATCTCAATTCTAGA
GCAACCTGGCTTTAGGAAGTTGATCGAAGCCCTAAGCAGA
GGCAAACGAGTCATGAGTCCGAATGCATTCGTCACTAGGC
TTGAAATGGCATTTGATAAAATGAAAACGGAGCTAAAAGC
GAAACTCAGCAAAGTACAGACATTATGCACAACCGCTGAT
ATATGGTCAGTGCAGGACAGAAGTTATTTTGGAATGACTT
GCCACTGGCTTGAAGACAATCTGGAAAGGAGGTCTGCTGC
TCTTGCCTGCACAAGAATCCCTAGCAACTACACTTGTGAA
ACAATTATTGCTAAAATTCAAGAAACTCATTCTTCTTTTA
ACATCGAGAGCAAAGTTCAGGCAACCGTCACTGACAACGG
TAACAATTTCGTCAAAGCCTTTAAAGAGTTTTCTTCTGAT
GATGAGCAAGAAGTGGAGCAAAGTCAGTTTGAGGATTTGG
GCAGTATTCTTTGTGATGGAGATATAGGTGGAGATTTCTT
TCTGAGTTATTTCTTACCACCACACCAGCGGTGTGCGGGT
CAAACATTGACCACAATTGCATCGAAGGATCTAGCGGAGG
CCGTCACAAAGGGACCGGCTGGCAAAGTTCGCAGCAGCGC
AGCTGGAAAGTGTGCAAAGATATGGCACAAGGCCGAGTCC
TCCATGGAAACTGCAGTTGCAATGGAATCCATTGCGAACA
TGAAATTCACACTTCCTTGCCTGAATCAGTGGAGCTCGGA
ATACTACGCCATTAATAAGCTGATGACACTCAATGATTCA
CAACTTAATGAACTGACCGAACTTTTGGGTGTCCCTCACT
TTACACCTGATGAAACATCGTACCTCACTGAATATACAGA
TGTCTTCAAACCAGTGGCTTTTGCTCTTGACCTTTTGCAG
GGCGAAGAAAAGTGTTTTCTTGGCATCGTGATACCAACAT
TGTTGACCCTTAAAAGAAAGCTTGAGGAAAAGGCAGCAAA
CACTCGCCTTTTCTCCAAGGCCATTGAAGAAACGGTAAAG
GCAATTGACACTCGCTTCAAGCAGGTGTTTGAGAGTTCTG
ATGCCAGGCTGGCCACAGTCACCACGCCTCAGTTCAGACT
GTGGTGGTTACCAGAAGAGGAGAGGGAAGTGCTTCGGGCA
CAGTTAATTACTGAAGTTCTACAGGTAGACCAAGGGACTG
AAGAACCAGAGACTAATGGAGGCGCCGTTCACGAGGATGA
ATTCTTCTCGTATGGACCTGGAAGTCCTGGCTACAAATGT
GGAAAGAGAGAAGCAGCGGAAGAGGTGTGGCTGTATCTGC
AGGGCACAAACAAAGATCTGAAATGCCTCAATGAATTTCC
AGGGGTGAAAAAAGTGTTCATCAAGTTCAATACAACTTTG
CCATCAAGTGCCCCTGTACAACAGCTCTTCAACAGTGGGG
GCAATAACGTCAACCCAAAAGGAAATCCTCTCACAGATGA
ACAGTTTGAGCATGTGCTCCTGCTACGCTACAACAGCAAA
ATCATCTCCGCTTTGGAATAAATCATGAGGTAACATTGCT
GAGGTTTGTTGTAAAATAGCTTCTTTTTACATGATTTTTT
TGTACAGTATAGGTCATACATATGCTCTGTCCTTTTTTAT
TTTGTCCCATCAAAATATTAGGTTCACACAAAAGCATTTG
CCACCAAAAAAAACTAATGTTTATTTCTTAGTAAACGTGT
AAACAAAGTTTGGACTAGTCTAGAACTGTTTATAGAATGT
GTTAGTCATTGCATAATGTAGATGCATACGAATATTTGTG
TCATGTTTAGAGCTGTATTATGCGTATAAATGCGTAACTA
ATCACACAAAAGTTGCCACATTACTTGGCACTCGTACACA
CAATGCTTGGTGGAAGGAATGTTTAATCTGATTATCATTA
CTAATAAAATTATTTTCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations