ZFIN ID: ZDB-TSCRIPT-131113-505
Transcript Name: zgc:161969-201
Previous Names: ch211-194e2.4-001, zgc:161969-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054391 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054391|OTTDARG00000037986|ZDB-GENE-030131-2597 zgc:161969|OTTDARP00000042724 CH211-194E2.4-001 LG_none CR854926.5,CU683898.8 Danio rerio protein_coding KNOWN, 2501 bp
GGAAATGCGCCTCTGTTGTTTGGTAGTAACGGACTACTCG
ATATTTGGATTACGTAATTAGATTACAAAAATCTAGAGTC
TGCATCTGGAATAGGATATATTCTATTTATTTATTTATTA
CACTATTAAATAGTACTAAGCGAACGCAATTTACTGTGTT
TGTTCCTACGTTTTTAAAGCGCTGTCCAGACCGGAGCCTC
GTGTGAAGATGGAGAGATCTCGTACAGCTTTTGACCACTG
GATGCACAAACACTACTTCACGTACAGGGATACAAGAGGA
AGAAACATTACTGTTCAGTGCAACCTCTGCCTCCCGAAGA
TCAACATCTTGTCCACCGCAAGGGACTCCACGTCTAATCT
GAAGAAGCATTTAGAGAGAAAACATGCAGTGCCGTGTAGG
AAAAGATTAAGGGAAGCAGCAGGCATCGATGGATCAAGTT
CATTTGCAACAAACATTTTGGAAAATCAAACGGAAGAATC
ATCGGAAGCAAAAGATGATAAGAACGACTCCACCATTTAT
TATCAAACATCACAATCCAGGCTAAATGCCTTGGTTTTTA
ATTTTATCGTGGAGGATGTGCAACCCATCTCAATTCTAGA
GCAACCTGGCTTTAGGAAGTTGATCGAAGCCCTAAGCAGA
GGCAAACGAGTCATGAGTCCGAATGCATTCGTCACTAGGC
TTGAAATGGCATTTGATAAAATGAAAACGGAGCTAAAAGC
GAAACTCAGCAAAGTACAGACATTATGCACAACCGCTGAT
ATATGGTCAGTGCAGGACAGAAGTTATTTTGGAATGACTT
GCCACTGGCTTGAAGACAATCTGGAAAGGAGGTCTGCTGC
TCTTGCCTGCACAAGAATCCCTAGCAACTACACTTGTGAA
ACAATTATTGCTAAAATTCAAGAAACTCATTCTTCTTTTA
ACATCGAGAGCAAAGTTCAGGCAACCGTCACTGACAACGG
TAACAATTTCGTCAAAGCCTTTAAAGAGTTTTCTTCTGAT
GATGAGCAAGAAGTGGAGCAAAGTCAGTTTGAGGATTTGG
GCAGTATTCTTTGTGATGGAGATATAGGTGGAGATTTCTT
TCTGAGTTATTTCTTACCACCACACCAGCGGTGTGCGGGT
CAAACATTGACCACAATTGCATCGAAGGATCTAGCGGAGG
CCGTCACAAAGGGACCGGCTGGCAAAGTTCGCAGCAGCGC
AGCTGGAAAGTGTGCAAAGATATGGCACAAGGCCGAGTCC
TCCATGGAAACTGCAGTTGCAATGGAATCCATTGCGAACA
TGAAATTCACACTTCCTTGCCTGAATCAGTGGAGCTCGGA
ATACTACGCCATTAATAAGCTGATGACACTCAATGATTCA
CAACTTAATGAACTGACCGAACTTTTGGGTGTCCCTCACT
TTACACCTGATGAAACATCGTACCTCACTGAATATACAGA
TGTCTTCAAACCAGTGGCTTTTGCTCTTGACCTTTTGCAG
GGCGAAGAAAAGTGTTTTCTTGGCATCGTGATACCAACAT
TGTTGACCCTTAAAAGAAAGCTTGAGGAAAAGGCAGCAAA
CACTCGCCTTTTCTCCAAGGCCATTGAAGAAACGGTAAAG
GCAATTGACACTCGCTTCAAGCAGGTGTTTGAGAGTTCTG
ATGCCAGGCTGGCCACAGTCACCACGCCTCAGTTCAGACT
GTGGTGGTTACCAGAAGAGGAGAGGGAAGTGCTTCGGGCA
CAGTTAATTACTGAAGTTCTACAGGTAGACCAAGGGACTG
AAGAACCAGAGACTAATGGAGGCGCCGTTCACGAGGATGA
ATTCTTCTCGTATGGACCTGGAAGTCCTGGCTACAAATGT
GGAAAGAGAGAAGCAGCGGAAGAGGTGTGGCTGTATCTGC
AGGGCACAAACAAAGATCTGAAATGCCTCAATGAATTTCC
AGGGGTGAAAAAAGTGTTCATCAAGTTCAATACAACTTTG
CCATCAAGTGCCCCTGTACAACAGCTCTTCAACAGTGGGG
GCAATAACGTCAACCCAAAAGGAAATCCTCTCACAGATGA
ACAGTTTGAGCATGTGCTCCTGCTACGCTACAACAGCAAA
ATCATCTCCGCTTTGGAATAAATCATGAGGTAACATTGCT
GAGGTTTGTTGTAAAATAGCTTCTTTTTACATGATTTTTT
TGTACAGTATAGGTCATACATATGCTCTGTCCTTTTTTAT
TTTGTCCCATCAAAATATTAGGTTCACACAAAAGCATTTG
CCACCAAAAAAAACTAATGTTTATTTCTTAGTAAACGTGT
AAACAAAGTTTGGACTAGTCTAGAACTGTTTATAGAATGT
GTTAGTCATTGCATAATGTAGATGCATACGAATATTTGTG
TCATGTTTAGAGCTGTATTATGCGTATAAATGCGTAACTA
ATCACACAAAAGTTGCCACATTACTTGGCACTCGTACACA
CAATGCTTGGTGGAAGGAATGTTTAATCTGATTATCATTA
CTAATAAAATTATTTTCTGAA

zgc:161969 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:161969-201 2501
zgc:161969-202 (1)    Ensembl 2745
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:161969-201 Contained in:
[BAC] CH73-193C12 (1), CH211-194E2 (1)

Genome Resources: Vega_Trans:OTTDART00000054391 (1),  Ensembl_Trans:ENSDART00000109151 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134839 (1) 2528 nt
GenBank:EH995877 (1) 942 nt
GenBank:CT685157 (1) 767 nt
GenBank:BI891385 (1) 759 nt
GenBank:BI891504 (1) 745 nt
GenBank:DT076009 (1) 739 nt
GenBank:EB946107 (1) 517 nt
GenBank:EB869030 (1) 470 nt
CITATIONS (2)