ZFIN ID: ZDB-TSCRIPT-131113-492
Transcript Name: si:dkey-276j7.2-201
Previous Names: dkey-276j7.2-001, si:dkey-276j7.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054270 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054270|OTTDARG00000037912|ZDB-GENE-131127-420 si:dkey-276j7.2|OTTDARP00000042635 DKEY-276J7.2-001 LG_ BX950218.13 Danio rerio protein_coding PUTATIVE, 786 bp
CAGAGATGTCGACGACACACACACTGAAGATGAGCGCTTC
TGTACAATACATCAGAAAACTACTGGGCAAAAGCAGCTGC
GCCACAAACAACTTGCTAAACACTGGACACAAAATACAAA
GGAAAACTAGTGACTGTAAAACTACCAAAAACAAAGACGG
AAAAACCCTTACAAGAAAGGTTGTGCAAACTCAAGATAAG
ACAGCAGAGCAGTGCATAAGGAAAAGTGTGATATTACGAA
GAACAGAAAATGAAACTTTTGGCTTTGAAATCCAGGATCT
GGTCCCTTGTGTGTGTTTTGTGAAGGAGGACAGTCTTGCG
GAGAGCAGTGGGTTAATGACCGATGATGTTATTATCGCAG
TCAACAGTGTGTCCATTGCTGAATTCACTCAACAGCAGCT
CAAGGATCTGTTTCAGAAGGCATCCATCTTAATGCTGGAG
ATTGTCAGAAGCTCTACAGAAAAGCAGAGACAGTTGCTCA
TCAGACTTTATCTCCTTCAGCGAGAGTTTGCAGAGAAAAG
CGCTGAGCTCCAGACACTCAACACAGAGGAAGTGCGTCTC
ATAGGAGATGCCATGAATCACATTCAGCAGCCTGATGTAC
TTTCTAAAGGATCTTCTGCTGCACTTTCTGAAAGAACAGA
TTGATTTAACACACATTTGAACAAAAACAAATAAAGGTTG
TGGGCTTCACTTCAGATGATGCGCTGGTGGATTACAGTAG
GACCGAGTATCTACTCTGTGGGCACCTGGACTTTAACACG
GTGTTTGTGAATTCAAAAAACTACTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-276j7.2-201 Contained in:
[BAC] DKEY-276J7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000054270 (1),  Ensembl_Trans:ENSDART00000156854 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DR721627 (1) 778 nt
GenBank:EB989572 (1) 642 nt
CITATIONS (2)