Transcript

si:ch211-194e18.2-201

ID
ZDB-TSCRIPT-131113-491
Name
si:ch211-194e18.2-201
Previous Names
  • ch211-194e18.2-001
  • si:ch211-194e18.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054261 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054261|OTTDARG00000037908|ZDB-GENE-131127-375 si:ch211-194e18.2|OTTDARP00000042628 CH211-194E18.2-001 LG_ AL772382.29 Danio rerio protein_coding PUTATIVE, 2279 bp
TCTCTCCTCCTCTCTTTCTTTCTCCGTCTCCATCACTATG
GAGGAAAAGCACACAGGCGGTGGAAGCATGCATGAGCTCA
GGGCGTTAAAACAAAAAAGCACAGCGTCTGTCTTTCTGGA
GACCTGAAGATCCGTTATAGTGATGAGCGTGCGAGAGAGG
CTGAGCGGGACACGTTACCAGGGAGACGACGGTGATGATG
ATGATGATGAAATGCATTAGCCTCTCGTATGGCACGTTTC
CTCAAGTCTGAAGGAACTTAAAAAGCTGTTATGCCAGCTC
CTGCCACTCAGGAGAACATCATGAAGTCCCAGCAGAAGTG
TATTGCTGTGTTTGCACTGGTTTGCTGCTTTGCTGTCCTG
GTGGCTCTGATATTCTCTGCTGTGGACGTTTGGGGCGAGG
ATGAGGATGGTGTCACTGAGGAAAACTGCAGCAGAAATTG
CCGCATTGTCCTTGTGGAGAACATCCCAGGAGAGCTGTCG
TTCAATAGTTCGTCTCATCTCCCGCTTACTGTGGGTCTCA
ACCACCTTTTGGACCAAGCCAAACTGTCAGTTGAGATAGT
ATCTCCATACTGGGCTCTGACCTCCACCGATCAGGGGGCA
CGGGTTTACACTTCCTATCAGGGTCAATATTTGTTTCAGA
GATTGTTAAGCCTGAAGTCTCGAGGTGTCAAATTAAAGGT
TGTCAGTGACCAACCCAACTCCACTGAGCTGAAGAGCATG
GCTGATCGCTATGCCGAAGTTCGCTATGTCAACATGACGG
CCCTCACCAGAGGACGACTGCTTTCCTCCTTTTGGGTCGT
GGACAGGAAGCACATTTACATCGGCAGTGCTGGAATGAAC
TGGAAGGCTCTGTCCAAGCTGAAGGAGCTGGGGATCATAG
TGTATGACTGCAGTTGTCTGGCTATGGACCTGCACAGGAT
CTTTTCTTTCTACTGGCAGCTGCAGTACAGGGACTACATC
CCTTCAATCTGGTCCAAGAGAGTCACAGCCGTGTACAGCC
GAGACGAGCCGCTCCAGCTCACACTCAACAATACAGACGC
TTCTGCCTATGTGTCGACGTCACCAGAGCTGTTTTGCCCG
AAGGGTCGGAGTCGAGATATAGATGCTATACGACATGTGA
TCCGAGAAGCGAAGAGATACATTTACATCTCTGTAACTGA
TTACCTGCCCTTAGTCAACCGGAGCTTTAGAGGATCAGCA
ATCATAAGGTACTGGTCGCCAATAGATGAGATGCTCCGCG
AGGCTGCAGTACTGAAAGAGGTCAAAGTTCGTCTTTTAAT
CAGTCTGTGGACTCGAACACATCCGCTGACCTTTAACTTT
ATGACATCAATGCAGGCTTTGTGCACAGGACTGCCAGTCT
GCTCTATTGAGGTGAGATTTTACAGAGGCAAGGAGCAGAT
GGGCGGATTTCAGCACAGGATGAATGAGAATAAATTTGTG
GTAACAGACAACGCAGTGTACATTGGAAATCTGGACTGGG
TTGGCAGTGAGTTTGCCTTCAATGCAGGAGCTGGGCTGGT
GTTTCAGGAACCAGAGAACCAGCAGGACGGACGAGACTCG
ATTGTAGAGCAGCTGACGGCTGCTTTTGAAAGAGATTGGT
TTTCACCCTACACAATAAGCCTGCTCTCTGGCAGCACAAC
CTTACAGGAGAGCCAACATGGGAAGCAGAAACTGCAAAGT
CTGAAGACAAAAACAGAAAGCAGAGAGCATGAGTGAGTTT
CTCTGCGGGAGTTTCTCTCTCAAGCGGGACCAATAAGCCA
AGGACTTTGTGCCTCAGAACATCTGCGCCATGACTCTTAC
CATTTGAATTTTCAAATGCTGTCGATGGAACTGAATTTTA
ATCTCTGAAGGACTTCTGTGAAGGAAACTTTCGTTTTGAC
ATCTAAATACAGCACTTTCAATGTAAAACTTTACTCTTAC
ACTCAATGGTTATATATAATGCATGCTTATTTAGATAAGC
AAACCTGAGAACTGTGGAAATGTACTCCGATATTCAGACT
TTGCTCATTTTAAACCAAAATATTCAACTACCGTGGGAGT
TTTTTCAGAGAAAGAACATTGCCAAAATTTTATAGTCATG
CAAGTTTGTGTTTGTTTGTTTTTTTCCAAGATGTTTATTA
ATCATCATTTTTTAAGAATTAAGCACATTTTTACTGAAAG
AGATTTTGAAGAACAAATGCCAAAGCACACTGCGGCCTCA
TACTGTAGCTGTCATTGCTTTCTGTTTGATTCAGCCTGAT
CTCATAAGCAAACGTAACTATTGTACGGATTGGCCAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations