Transcript

ano10a-201

ID
ZDB-TSCRIPT-131113-481
Name
ano10a-201
Previous Names
  • ano10a-001
  • ch73-269i6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054179 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054179|OTTDARG00000037855|ZDB-GENE-050913-43 ano10a|OTTDARP00000042565 ano10a-001 LG_none 57393 1 CU856516.14,CABZ01061363.1,CABZ01061364.1,CABZ01061365.1,CABZ01043032.1,CABZ01043033.1 Danio rerio protein_coding KNOWN, 2641 bp
AATATCACACTAACCGAATCAGGGGTTTTAAATCAACCGG
TTTAAATGGGTGTCTAATGTGCAGGACTGACGTCTATTCG
CATTCCGGGCAGCTGATCGCGCGTGCAACACTGGATCAGG
AAAAATGCAACTTGGCTTGTCGGTTTCTGACAGTGATGCG
TCTCCGTTCACCCCTCTGGTGGTCCTGGAGCTTGCTCATG
ACACTAAAGCAGAGGCCATCGCTTGGTTACTAAACAGAAT
CAGAGACAAGCAGCGTAATGGAGGAGCAGAGCTGTTGGTG
GACCAGCTGCTGTTTCCAGCTCAGGATGGTCAGAAGCCAA
ATCCAAATGTTTTTGTTGTGGGCTCCACGTTACAGAGGCT
TTTAATTGGAGCTGAAGATGTGGGCTTGTTTAAGGAGTTT
CAAGATGGCACAATGCGCGGGTTCACTTATGCCAACAGAG
AAAGCTTCAAAGACTTTGAAGGAGACGGTGAAGGATTTCT
CAGTGATGCGGAGTGTCAGTATATTGTTAAACATGAACTG
GATACACTTAGAGCGAAAAACGAAGAGTATATACCAGGAT
ATCCCAAGTATAAGCTTTACCCTGGAAAATCAATTGTACG
CAGACTGCAGTCTAAAGGTGTCCTTGTCCAGTATTTCCCT
CTCCATAACAAAGAAGACCTTAAGAGACTCTCGTTCTCGT
GGTACAAAAAGATCAAATTGTCCTTCCAGCCACTTGATGA
CATCAGAAGTTACTTTGGTGAAGGTCTGGGACTCTACTTT
GGATTTTTGGAGTATTTCACATTTGCCTTGATACCCATGG
CCCTCATTGGTATCCCCTACTACCTCTTCGATTGGGAGGA
CTACGACAAGTACGTCCTGTTTGCCGTCTTCAACCTGGTT
TGGTCTACAGTATTTCTGGAAGTATGGAAGCGGTGCAGCG
CTACGTTAGCATACAGCTGGGGAACTCTGGGCCGTAAAAA
AGCCTTTGAAGAACCAAGAGCTGGATTCCATGGACCCTTG
GGGTTGAATCCAGTCACCGGCCGAGAGGAGCCAATCTACC
CTAGCTCCAAGCGACATTTGAGGATATATTTGGTGTCGGT
CCCTTTCGTTCTGCTGTGCCTGTATTTGTCCTTTTACGTG
ATGATGGTTTACTTTGACATGGAGTTCTGGGCCATAAGCA
TATACCATGAAAATCCCAACTTTGCAACCAGCGTTCTGCT
GTTTGTCCCGAGTATCATCTATGCTGTGGTCATCGAGATC
ATGAACCTGCTGTATCGCTACGCTGCAGAGTTTCTCACAG
ACTGGGAAAACCACAGACTGGAGTCCTCATTTCAAAATCA
CCTTGTGCTCAAGGTTTTGGTGTTTAACTTTGTAAACTGC
TTTGCCTCTCTCTTCTACATTGCCTTTGTCATGCAAGACA
TGGTGCTTCTGAGACAGAGTTTGGCCACCCTGCTCATCAC
CTCTCAGATCCTGAATCAAGTGATGGAGGCATTTTTGCCC
TACTGGCTGCAGAGAAGGAGGAACAAGAGAGTCTATAAGA
GGATGAGGAGACTGATGGGTGATAAAGAACTCCCTCTGCT
GGAACAAATTCAGCTGGAGACTGAAATGAACACCTATTTG
GGCACGTTTGATGACTACCTTGAGCAGTTCCTGTTGTTCG
GCTATGTGAGTCTCTTCTCCTGTGTGTATCCACTGGCTGC
TGTTCTGGTGGTGCTAAACAACATCACTGAGGTTTATTCT
GACGCCTTTAAGATGTGTCACGTTTTCAAGCGTCCCTTCT
CAGAACCAGCTGCGAACATCGGGGTGTGGCAGTTGGCATT
TGAGACGATGAGTATTATTGCTGTGGTGACCAACTGTGCC
TTGATTGCTTTATCTCCACAAGTGAAAGCATATTTCCCGG
AATCGGATGCTCAGCTCATCCTAACTGTGGTGGCCATAGA
GCACGTGCTCTTGGCCTTCAAATTCATCCTGGCGTTCGTC
ATACCAGATGTTCCTAAACACATCCAAGTCAAACTATCCA
AGCTGGACTTCGAGTCCCTAGAAGCTCTTAAGAAAAGGAA
AATCCTGGAAGTTGCGGAGACCTGAAATACGTGGATTGAG
TGAGCTGTAACAGCATGACGGAAGTCCTCAATGTGTGGAC
ATGCTGTAAAACATCGAGAGTTATATTTAACTGACTTTAA
ATATGCACTCCTTGCCAGGCTATTCAAAACAAATGGCTTG
ATTATATTCAGGACATGACAGGGTTATTTTAATATACATT
TTTCCTGGTATTAGTTGCATGCATTGCTTTATGATTTCTC
GGTCAATACAAATGTTACTGGTATAATGAGAGACGGGTGG
GAATGTAGGAATCCGATCGTTGCATGTGTGTTAAGGGTTG
ATACATGTATTGTCAAATGACTGGGTTGATTTGTTTATCA
AAGTACACGGATATTTATTCTCGTCTAAAGCTGTAAAAGT
ATGTTGTATAAGACGTGTTTGGAAGGTTTTTAGTTTTCAT
TCACACCAACCAAAGACAGAGCAGTGCCTTTACACATCAC
TGTATCGCGTTCAAATGCTTTTGTTTACAGATGTCAAGCC
TGACTTTGCTCTGTACTGTACTTGAATTAAGCATATTCGT
TATCTTGTACCTGAATATAAACATTTTAAATATACAGATC
G

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations