header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4758
Transcript Name: si:dkey-79d12.6-201
Previous Names: dkey-79d12.6-001, si:dkey-79d12.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060000 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060000|OTTDARG00000041618|ZDB-GENE-131127-253 si:dkey-79d12.6|OTTDARP00000046469 DKEY-79D12.6-001 LG_ BX005256.11 Danio rerio protein_coding PUTATIVE, 603 bp
GGAAGCGGAAGAGCGAGGTGTCTGTGAGGAGGAATAATGA
AAAGGGAGAGAGAGATGGAAAGAGAGAGAGAGAGAAGGAG
GGAGGGGTAAAAGAAGAGAGCAGGACTGAGGAGGGTGGAC
TGGCAGAAACATGAAATACGAGAGGGAGAAGAGTAAAGTA
GGAGAGGAGCCCGTAAGAGGAGAAACGAGGGATGGCTGAC
CTGGAAGTGGGCAAATTCGGGGGGAAAGGAAGCCACCGTT
CTCATCCAACGCTTGCTGAAGCTGGGACGCATCACCTGAG
ATCAGCTCTGGTTCTCCTGAGGGACTACAGGTGTTCACTC
CTCATGCCACATCAGCAGACCAGCTGGTCAGTGATCAGGT
AACCAAACGTCTCTGTCCCAACATCACTCTCCAGCCTTTG
TCTTCTTTACCTACAAAACAGACACACACACACACACACA
CACACACACACACACCTGAGCTGAAACTCAGCTATGAATC
GAAACCTTAAACTCTTAAAAGCCTGTTTTCAGCCTATTCA
GTGGCGAAGCCTATGCTTATGTTCCTATGAGAACAGCTTT
AAAGCCCAGCAGAAATATGAAAGATATGAACCAGCTATTA
TCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-79d12.6-201 Contained in:
OTHER si:dkey-79d12.6-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000060000 (1)
  • Ensembl_Trans:ENSDART00000157333 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)