ZFIN ID: ZDB-TSCRIPT-131113-4709
Transcript Name: si:ch211-272h9.7-001
Previous Name: ch211-272h9.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059842 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059842|OTTDARG00000041497|ZDB-GENE-131121-111 si:ch211-272h9.7|no_translation CH211-272H9.7-001 LG_ CR847899.28 Danio rerio antisense NOVEL, 680 bp
GTTAGCCTGGACAGACCATACACACACTCAAGGTGATACG
GCAACCAGAAGAGGGTGAAAGCAGCAATGATGATGAGGAT
GAGAAAGTTTCCTCTTCCCTTACGCTGGAACATGGCGCTG
CGCAGCCGAAGGATGACTGAGATGTAGCAGAACAGGATGA
AGGCGAAGGGCAGCAGGAAGCCCAGCAGAGTCTCAGACAG
ATACCGGATGAAAAGCGGAGAACTCAGGAGCACCAGAGCA
TCAGCCACGGCCAGATTCAGAATCAGCAGACAGGTGACAG
AGCGGCGCCGCACTCGACACAGTACCGACCACACTACAAA
CAGGTTACCGGGAAAACCAAACACAAAAGCGATAACCAGG
ATCGCAATGCCAATCTGATGGGACAGGGGCAGGGATGGTG
GTGTAGATGGGGGAGCGGGCACAACGGCGGATGCAGGTGG
TCCAGAGAAGACCGGAGTTAAAGGAGTTGCCATTTGAATC
AAACTTTATGGTGTTGCTTCTTGAATTTACTGTGGAAAGA
AAGCAAACAGAGCAAGAACATCAAAACCAACATCTATTTC
CCTTTCATCTGTAGGCTATAATTATTTGTCAAACACATTT
GTGGTTCTCTGTTGCTGGACAGTTAGAGACAATGTCGTAT
CATGATTTCTTGAAATCGTTCGGTTCTTGAAAATAGAGCC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-272h9.7-001 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000059842 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)