ZFIN ID: ZDB-TSCRIPT-131113-4664
Transcript Name: si:dkey-30k6.7-001
Previous Name: dkey-30k6.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059638 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059638|OTTDARG00000041352|ZDB-GENE-131120-148 si:dkey-30k6.7|no_translation DKEY-30K6.7-001 LG_none BX511179.5,AL844141.7 Danio rerio antisense NOVEL, 1932 bp
GGAGCGGAATAGTTTCCTTATCAGAAGCGATAATGAGGAA
ACGACAATAATGATGAATCATGGAGGTGGAAACATCTCAA
TATCCCGTCTGTGGAGTATCTTCAACTAACTAAGCCACTG
CATATGGTCCAGAGTATCAGCTGGTTTTAATACCTCATTA
TGTGACTGGAAGTTTCACTCCAGACTGTGGATTAAAGTAG
CCAGTTACTTTGTAACCAGTTGCACTCAACACTGGTTGTA
CAGAGGGAGGAGGAGGGATGACCTGCATGTTTTTGAAGCT
GAAGTAACACTGAGCACTGAGTAAGTTCTGTCTTTGACTT
ACCAGACTGCAGCACAGGCTGGAACTGACCAGCCATGCAG
ATCTCATCTTGTTTCTGGCGCACAAGACGCTGGATTGCTG
GAGGCAGGCCACGGGGGTTACGTGAAAAGACCAGGGAATA
TCCGTCATCACATGAGCCATCATCCTTCAGAGTGCGGCAA
GCATAGATTCACAGCCTACCCGAAAAGAGTTACTCGGCCC
TTGGACGAGGCAGTCATGGTTCCATCATCATCGATTGTGT
ATTCGGCAGAGATGTTGTCCTGGAGGAAGAGTCCCTCTGG
GTCTTTCTTCTGCTGAGCGTACCATTTGCCTGCATACTAC
AAAGTAAAATACACCAGGTCAGGTCAGGCTGTATGCACTG
CATTAACAATGAGCAAACGTTTGTCCCCATTGAGACAATC
AAACAGCATACAACATACCCTCTTGGGGTCAAAGTCGTCC
TTGACTGTAAAACTCTCTACAGCGCAGGATGCAGAAAAGC
AGCGCTCAATGTATGACAGGAAAACCACCAGCAGGGCAAA
CTTGTAAAATCCCATTCTGAGCAGCCGGAGATGAAAAGAA
TGTCATCTTATTGGCTATTTCCAACAGTTATAACACTAAA
ATAATATATATTTCCAACAGTGTTTTTCAATAGTTAACCT
CACAATTGTCTAGATCTTACCTGCTTGTTTTGATGATGTC
CTGAATGAATGAAAGAATGGTTTTAGTAGTGTAGGATCCT
TCTTTGTGGTTCTCCACAAGGCTGTGTTGTCTAAACTGAC
CAAGAGCCCTTTTATACCAACTCCACAGACAGGCTTATTG
ATTATTTTCACTTCTTGTGACTAAATAGGGTTCTTAAATC
TACGGTTAATCCGTTTGTAGAAATCCTCACTGTAATCTGG
CTTCTCGGTTGAACCCTCCCATGCTTGCCATAAAAACAAT
TAAAGCTTTATGCAACTCAGTTGAATACGGTGAGACTTTG
TTTAAGCAATCCAATCACATCTGGAAGCAAAGCTAAAAGA
ATCAGTCTGCTAGCATTATTTGTGTAATTGTGTTATGCAC
TGCATTATGTAATGTTATTAGGTTGCTGGCAATTTCACAA
AGTGAAAAATAGATTTACAGTATAGAGTAGTTTTCTCAAG
TAATATGCAACTCATAATAAATATTTTTATATTTTCAGTC
CAAAAATTGGTCCTTTTCATCTCTTGATAGATGTGATAGC
AAAGAAGAACGTGCTTTGGTATGCAAGATACTATGTTGTA
GTGGAATGATTGTGCCACATGTTTCAGAGTTGACAATGGC
CATCTACTGGCTTTGTGTTGTTTTGATGAGATAGATGTGA
TTACAAAGCTGCTTTTTTATTATAAGAGTCTGTTATGTAA
GAAGGTACTTGGCACATTGTTGAAGATTTATGTGGTGTGA
TCAGTTTCATAAGGTTAAAGAGGGCCTTTTTAATAATAGC
ATATTTGTGTACTAAAAAAAAAGACTTTACCAAACAAAAT
CTAGAATATACCATAATATATCTATGATTACATGTTCTCA
ATTGTTCCATTTTTATTTATTCATGTGTACAGTCTCCTAG
TTTCCCTCATCGTTTAAATTGACACTCTCAAAAATAAAAA
TGGAAATCTTGT

si:dkey-30k6.7 TRANSCRIPTS
Type Name Length (nt) Analysis
antisense si:dkey-30k6.7-001 1932
si:dkey-30k6.7-002 (1) 1685
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-30k6.7-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059638 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)