header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4527
Transcript Name: nmur1b-201
Previous Names: nmur1b-001, dkey-185p13.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059056 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059056|OTTDARG00000040943|ZDB-GENE-131121-154 nmur1b|OTTDARP00000046125 DKEY-185P13.2-001 LG_ BX571948.8 Danio rerio protein_coding PUTATIVE, 1211 bp
GATACAGTACAACTGCTCCTCTCCAAGTTCACTGTTCACA
GTTGTTGTGAACACGTCATGGTGCTCCACCAAAGAAGAAG
AATGTCAAAACAGAACAGCAAACCTATCAGACCTCTGTCT
ATCCCGCAGTGCCTACCTGGAGAAATACCTTGGACCCTGT
CGTTCACCTTTCTTTCTGCCTATATGTGTCACCTACCTGC
TCATCTTTGTAGTAGGTGTGGTGGGCAACATCCTAACTTG
TATTGTCATTACCCGTCATCGCATCATGCGCACAACGACA
AACTACTACCTGTTCAGCCTGGCCATTTCTGACCTCCTTG
TGCTGTTGCTTGGCCTCCCGCTGGAGCTTTATGAGCTCTG
GAGCAACTATCCTTTTCTGTTTGGAATTTCTGGCTGCTAC
TTCAAAACCTGTCTCTTTGAGACAGTCTGCTTTGCCTCTG
TTCTCAATGTTACAGCCTTAAGTGCAGAACGTTATAGAGC
TATCATTCATCCTCTGCACACCAAACATGTTGCGACGAGT
GCTCATGCAAAGCGTGTTATCCTTGTGTTATGGGCTGTCT
CTCTATTGTGTGCCTTGCCCAATACCAGTATTCATGGTGT
GGAGATGTTAAAACCCCGTTTTGGACTTACTTTCCCAGAA
TCAGGTGTGTGTACAGTGGTACACGATAGGTGGATCTACA
ACCTGCTGGTGCAAGTGACAGCACTGCTGTTCTTCATACT
GCCGATGCTGACTATCAGTGTGCTGTATGTGCTGATTGGC
CTACAGCTGCACCGGGAAAGGGAGTGCTTTGATTCAAAGA
TCGTGCTCAATCAGGATGGGGTCAATCAGAGGGCACGTCA
TCGACAAGTCACAAAAATGCTTTGTGCATTGGTGATTGTG
TTTGGAATCTGCTGGGCTCCCTTTCACATTGATCGTGTAA
TGTGGAGCTATATTGATGACTGGACTGCAGAGAACCACCA
CATCTTTGAGTATGTGCATCTTCTATCTGGTGTCTTCTTC
TACTTGAGCTCAGTGGTCAATCCCATCCTGTATAACCTCA
TGTCTTCGCGCTTCAGAGAAATGTTCCGTGAGGTGGTGTG
TCAAAAAGACCATCGTCAGCTCTCAATGAGTAGGGTCACA
TTACGTAGTGTTGTTTCTGCCTCTTTTTCTGCCTCCAATA
CAGTCTCATTTTCTGTAAAGTTCAACCCACGTGAGCTGCC
ACACACACTCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nmur1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059056 (1),  Ensembl_Trans:ENSDART00000017787 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)