ZFIN ID: ZDB-TSCRIPT-131113-4511
Transcript Name: dnajb4-201
Previous Name: dnajb4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058996 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058996|OTTDARG00000040896|ZDB-GENE-040801-192 dnajb4|OTTDARP00000046074 dnajb4-001 LG_ CU929379.7 Danio rerio protein_coding KNOWN, 1948 bp
CACAAGATCTTTAGTGCTGAGTAACCGCCTCCAAACAGAC
ACAAAGAGATCAACTGATCATCTGTATCACGGTTTAAAGA
GGCAGGATTTGACAGTGTAGCGCTCTTATTCGCCGTCTTC
TTTATCAACCGACAGTCGAATCCTCGGGCAGCGGCAGCAG
CGCGGTCTGCATAGTGGAAAATGGGCAAAGATTATTACAA
AATACTGGGAATCACGAAAGGAGCATCAGACGACGATATC
AAGAAGGCGTACAGAAAGCAGGCTTTGAAATGGCATCCTG
ACAAGAACAAGGCAGCCAACGCTGAAGAGAAATTCAAGGA
GGTCGCAGAGGCTTATGAAGTTCTCAGCGATCCAAAGAAA
CGAGAAATATACGACCAGTATGGAGAAGAAGGTCTTAAAG
GAGGTGGAGGAGCGTCCGACGGCCCAGGTGGCAACTTCAC
CTACACCTTCCATGGAGACCCTCACGCGACATTCGCCACG
TTTTTCGGAGGAGCCAGTCCTTTTGAGGTATTTTTTGGCA
GGAAAGTCAACGGACGAGATGAGGACGACATGGAAGTGGA
CGGAAACGATCCTTTTGGTTCCTTTACGAGTTTTAACATA
AATGGATTTCCACGCGAACGGCACGTAGGTCAAGGTGGCC
CGCCACGCAGGAAGCAAGACCCGGCTATCCACCACGAGCT
CCGGGTGTCACTTGAGGAGGTTTTTCACGGAAGCACCAAA
CGCATGAAAATCTCACGGAAGCGCTTAAATCCGGATGGTC
GAACCTTGAGAACCGAGGACAAAATCCTCACTATTGAGAT
AAAGCGTGGCTGGAAAGAGGGAACCAAAATCACATTTCCA
CGGGAGGGTGACGAAACGCCTAATACTATCCCTGCCGATA
TTGTGTTTGTCATTAAAGATAAGCCTCACGGCCACTTTCG
ACGAGAGGGGTCTGATATTGTGTATCCAGTCCGGGTCAGT
CTGCGCCAGTCATTGTGCGGCTGCTCCGTCACTGTGTCGA
CGATAGATGGTAAAACGTGCAATATGAAGATAACCGACGT
CATCAAACCTGGCATGAGGAAGGTCATTGCTGGACAAGGA
CTGCCCTTCCCAAAGAACCCAGAGCAAAGAGGGGACCTCA
TAGTGGAGTTTGATGTGAACTTTCCTGAAAGCCTGCCAAC
TAATGCCAAGGATGTCCTGAAACGGCACTTACCGGTCTCA
TAAGCTTGGACAAACTTTAGCAACATTTCTACAAGAAATT
CAGTCCCTGAATCAAATTTTGAGAATGTGCAATTTCTATT
TTTATTAACTAAATGTTTGTTAAATATGTATGTTATATAT
CTAAATACACACATATATGAATCATGTTGCATGACTGTGT
ATGTCAGTGACAGTGCAAGCTTAAAGTGCAACCTGTTTTT
TATTTCCCTGCTTGATTTACTGTTATTTTTATGCTTAATT
TGAATTGTGCTGTATGTATTGTTTCATAACGACAGTATTC
TAAATGATATTGATTTATTTGTATGCCTTTTCAAGTAAAT
CTCACTTGTGCTGACAGAACTAATACTTCAATTCAAATAC
TGTTAATACTTCTCTCTAGATGCACAATATGGTATGACTT
TAGTAGATGATGTTTTGGAGTGGTCCGTGTGGCTGTACCA
TGGATACTTGCCTTTATTTATGAAACTACAGCATACAGCA
CGACTAAAATAATGCCTTTTCAGATCTGATATGTCAGATC
TTTGTAATTGTGAGCGACATACTCACGTTATGTAACTGTC
TTTGACAGAGACCAAAAATGGTTACATGTGCTGTGGGTTC
ATAGCATACCTTGTTTATGATATTTGGAGAACATTTGCAT
AAATCAAAGTATTATACTTTATATTTTTACTCTGTAGCCT
GTTGACTAGTGTTTTGTGTTTGGGAGTCTTGGTTACATTT
TTAGCCGAATAAAACAGGAGTTACAGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnajb4-201 Contained in:
[BAC] CH73-82N5 (1)

Genome Resources: Vega_Trans:OTTDART00000058996 (1),  Ensembl_Trans:ENSDART00000056896 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC077166 (1) 1990 nt
GenBank:GO940859 (1) 767 nt
GenBank:DN892906 (1) 737 nt
CITATIONS (2)