ZFIN ID: ZDB-TSCRIPT-131113-4503
Transcript Name: zgc:174263-201
Previous Names: dkey-33c14.1-001, zgc:174263-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058866 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058866|OTTDARG00000040812|ZDB-GENE-030131-4589 zgc:174263|OTTDARP00000045968 DKEY-33C14.1-001 LG_ CU693494.10 Danio rerio protein_coding NOVEL, 4382 bp
TGCGGCCCTCCAGGAATCGATTTTGACACCCCTGCTTTAG
ATAAACTCTCCTGCAGGGTCTGCTCACTCCAGTAGGAGGC
GCTGATGTAAAACTTTCCCACCATCACTAAAACTCCAGAA
GCTGCAGCAGAAGAAGAAACGCAGCACGACTGTTGCCATC
TTGTTGTTAGCATTAACCTCCGCACTCTTTATACTCCATA
ACGGAGATTAATAATCATATATCCCGCGGCTACATCTCAG
TAAGGACAGCATTTAATCCACAGAAGGAAGCAGTTCATGA
ACTGAGGCGAAAAATGCCGCGAATCTCCTAAAAGCGACGG
AGACTATTCAGAGAGTCCGCACACAGGCCGAAATCAGTGT
GTTTAGTTATTAAATGATGTCTTCTGCACACACTGCTGTC
AAGACTGAGTTTATAAAAGAGGAGAGCGAAGAAGTGCGGA
TTCCTGAGCCGTGTGGAGATGAAGAAGAAGAAGCCTCAAC
CCTGAAGAAGGAAGAGCCGGAGGAACACACAGAACAAACC
GAAGTGAAGGAGGAGCGAGAAGAACAGCATGAGCATGTTT
ACGACTACGAGCAGCCCCAGTACCTGAGCTGCTCGCTGAA
CGGTAAAAGCCTGACGCAAAAAAGAGCGGAGCGAGCAGGG
TGCGGGTTTTTCTTCACCTGCCTGGAGTGCAAGAGGAGCT
TCGAGTCTAAGGAGCACCTGATGGAGCACTTCAGGAACCA
CACCGGAGAGAGCTGCACCCAAACACAAGTGTTCATGCCT
CAGTGCACCACCGAAAAAGGAGCGTGTCCGTTACCGTTCA
CCTGCCACCAGTGTCAGAAGAGCTTCACCTGTAAAGACCA
TCTGCTGCACCACTACCGCATACACACGGTGGAGAAGCCG
TTCCCCTGTGACGAGTGCGGCAAGAGTTTCATACACAAGC
AGAGTCTAAAGAACCACCAGAAAGTTCACTCGGGATTGAG
GCCGTTTGTGTGCACGCTCTGCGGGAAGAGCTACATCCAT
AAAGACAATCTCACAGACCACATGCGGATCCACACCGGAG
AGAAACCGCACACCTGCAAACTCTGCGGGAAGAGCTTCAC
GCATAAAGGAAGCCTCCTGCACCACATGAAGATCCACACC
GGACTCAAACCCTTCACCTGCAGGCAGTGCGGACGCCACT
TCACACACAAGGGAAACCTCAAAATCCACATCCGCATTCA
CTCCGGGGAGCGGCCGTTCGTGTGCTCGCAGTGCGGCAAG
ACCTTCATTTACCACGGGAATCTGATGGGCCACTTGAAGA
AGCACTCTGGGGAGAAGAAACACCGCTGTGAGGAGTGCGG
CAAGAGTTTCGTGGAGGCTCGACACCTGCAGAAGCACATG
AAAACACACGCCACGGTGCGGCCCTTTGTGTGTGCACACT
GTGGGAAGGACTTTTTGTGGCCGCACAACTTCAAGGAGCA
CATGAAGGTCCACACCGGAGAGAAGCCGCACGTGTGTTTG
GACTGCGGGAAGCCCTTCACCAGGCAGATCTACCTGAAGC
GGCACCAGAGGATCCACTTGGGGGAGAAGCCGTTTAAGTG
CGAGCGCTGCGGGCTGTGTTTTACCACCATGGATTCACTG
AGGGTGCACGAGCGAGTGCACACTGGTGAGAAACCTTACA
AGTGTCCATCCTGCCACAAGAGCTTCGGCAGATTGAGTAC
GCTGCTGACGCACAAGAAAAAACACTGCCCCATGCTGAGG
AAGTGAACGCCAGTAGAGAAGTGCTTTATAAGATCCTGGT
GTAGAGAGTGCTGCTCAAAACGTCTTAGAGGGGCAGTTCA
CACTGAAAGAACATTCACTCACTGTTTTACTCTCCAGTCA
AATCTTTCAGACCTTTATGAGTTTCTTTCTTCTGTTGAAC
ACTAGGGATGACAGCTGCAAGACTGACGTTTCGACACAGT
GTCGAGATCCCAAAGTGCAAGTTTTTGCAACACTGCACCA
AAGCATGATCCGAAATACCCAGGTAACGTGACTTAAGCGG
TTTGAAATATCTAGGTTATGTGACTGAAGCAAATCGAAAC
ATTTAGGTCATGTGACTAAAACAATTCGAAACACCCAGGT
CACCTCACTAAAGTGATTTGAAAAATTTAGGTAATGCTAC
TAAATCAATTTAAAACACCCGAGTAACACGACTAAAGCAA
TTCAAACCACTGTGGTCATGTGACTAAAGCAATTCGACAC
ACCTGGGTCATGCAACTAAATCAATTCAAAACACCTGAGT
CACACGACTAAAGCAATTCGACACACCTGTGTCATGCGAC
TAAAGCAATTCAAACCACTCTGGTCATGTGACGATTTGAA
ACACTCAGGTGACCTGACAAAAGCAATTCAAAACATCTAG
GTCAAGTGACTAAAGCGATTTGAAACACTAAGGTTACACG
ACTAAATTGTTTAGAAACACTCGGGTCACGTGACTAAAGC
ATTTTGAAACACTCAGATTACACGGCTTAAGTGATTTGAA
ACACTATGGTCACGCAACTAAATTGATTTGAAACATTTAG
GTCAGGCTAATAAATCGATTCAAAACACCTGATCATGCAA
CTAAATTGATTCGAAACACCTGGGTCATGTGACTTAAGCA
ATTTGAAACATCTAGGTCATGTGACTAAATTGTTAAGAAA
CACTGGTCATGCGACTAAAGCAATTCCAAACTCTCAGGTA
ACGCAACTAAATCGATTAGAGACACTCTGGTCATGCAACC
AAAGTGATTCAAAATACTTTGGACATGCGACTAAATCGAT
TCGAAACACTTGATCACATGACAAAAGCGGTTCGAAACAC
CCAGGTCACGCAACTAAAGTGGTTCGAAACACTCGGGTCA
CACAACTAAAGCGATTTGAAACACCCAGGTTATTTGACTA
AAGCGATTCTACACATTTAGATCATGACTAAAGCAATTCG
AAAGACCTTTATGAGATTTTATGCATGCTTTTGACAACTG
TTAAGCTTCATTCGCGCAGTTATGTCATTTTAAGTGCAAA
GATGACAGTTTGTCTTTTTTTGATGGCAGCATGACATTAG
ACAACAGAACTTGTCATAAATTTGTCATAAACAAAATGGC
CATGAGGCATTATTATTGTGAGTTGACTAATCACATTAGT
CATTAAAATGTCAATAATAGTTTTAAAGCAGAATTAATTT
TGATTTACTGTAAAATGGATCAGAAATATATTCATCACAC
AGTTATAATGACCTCATTACAATCATGTTTATGACAGAAT
AAATGAATCAAACAAGTGATATTTTATTCATAAATACAAA
AAAGCACATTTAATTATTTTTCAAATATTTTTTCCTCCTT
GATGCACTCAACCGACATACACTGTCTAGGGATTAGTGAG
TGAGTGAGCAGTTTTGAACACAGCCATTGATCTCTATATT
TACTGTCCTACTTTGGAAGTCAATGGTTACAGGTTTTCAA
CATTTTTCAAAACATCTTCATTTGTGTGCAACAGAAGAGA
ATCTCAAGTTTGTGTGAAAGTGAAGCTAAATAAATGAGTT
AATTTAGATCTTTTTAGTAAACTGTCCCTTCATTTATTTT
TTATTTTTTGTAATTGTATTTGTTGTAAGGTGATGCATGG
ATAAAATGGTAAATACATAAAACATGTCAGACTCGCTGCC
GTGGGACACAAACTCAGATGTTGTCTACTGAAAGTCCAGC
ATCTAATGTGTTTTAATGGGAAACGGTAAAACCAAAATAA
GCACCTTAGAAAAAGAGTTTAAAAGAATCAACTGCTGTGA
CATTTTATATAACAAAATTAATTAAAAATGTTTGTTTCTG
GAGTTCAAAATGAACAAATTAACCCCTTCAAGGTCCGATT
GGTCCATGCTGTTGATGTAATATGTGGGTGTGGCTCTGGG
GCTCCGCCTCCTCTCTTTTTTCATTCCTGCAGCAGTCAGT
CAGAATCCAGCATCCTATAATATACACAGTGAAGAGATGC
TGAATGCTGTAGAAATGTCAAATTTCAGTCAGTTTATGCT
GTTGTTCAGCTCACAGAATGCAACATACACTGATATAATC
TAATCAATCCAGAGTAAACAGTCTGTCAGTCTTTAGAAAC
AACATGAGAAAAGAGCTGTAAGAGTGTTGATCTCATGTAA
TCACTGGCCTGAAATGTCATTGGTTCTCTAATGTTTGATT
AATGGCATGGATGAACGAGTCCTTTAGGCAACTCTTACTG
AATGGATGAGAATCTGTCTGTGTTCACATGTGTTTATTTT
GCGTATACTAGTGTGCTTGAATCTCTGTCAAGCACACTCT
GCAGAAATGTCTTAATTTAGTTGCTTTATACCCCAGACTG
AAGCTGTGTGGTGTATAATGTGTACATGACAAAATGAACA
TAATAAAAATCCAAATCTCCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:174263-201 Contained in:
[BAC] DKEY-33C14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058866 (1),  Ensembl_Trans:ENSDART00000155595 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD594700 (1) 650 nt
CITATIONS (2)