ZFIN ID: ZDB-TSCRIPT-131113-4472
Transcript Name: si:ch73-380l3.4-201
Previous Names: ch73-380l3.4-001, si:ch73-380l3.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057789 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057789|OTTDARG00000040266|ZDB-GENE-131125-97 si:ch73-380l3.4|OTTDARP00000045281 CH73-380L3.4-001 LG_ CU466279.8 Danio rerio protein_coding PUTATIVE, 2254 bp
CCAAATTTCATGTCGATGGGTGCCAGCAACCAGCTTTTTT
CAGAACATCATCTTTTGTGTTCAAATAGGGGGGTCCAATT
TTGCTGCATGTAAAAGTGTATGTGACAAAGGCTTCATCAT
CATCGTCATCATTTAACTTTGGTTTTTGTTTATGTTTGAC
ACAGAAACATGAATGCACCACTTTTGCTTCACTTACTTTT
TCAAGGTGTTCTGCTGTTCGGTGCTTTAGGATGGGAAGTG
AGAATGCCAAAGGAAATTCATGGCCTCAAAGGTTCCTGTA
TGGTGATTCCATGTTCTTTCAGCTACACAACAAACCCACC
TACAAAGCCAGACAAAGTTGTGTGGTATCAGTGGGTCTCT
AGTGGCTATCCTTTAGTCTGTGATCCTTCAAATTCAAATA
ACGTAATTGACAAGTTTAGAGGAAGAACTTCTTTATATGG
AGGCTCAAGTGGTGCTTGCAGTCTGCTGATCAAAAACCTG
GAACAGTCCCATCATGGAGAGAAAATATACGCATGGATCG
ACCCTGATAATATTGGATGGCGCACTTACAAATTTTACGA
TGTCACCTCTACAATCCGTGTTGATGCCCGTCCACAGTTA
CCCAGCATCAGTATTTTTGGTGGAGAGAAGATGGGGGACA
AGATTACAGTAACCTGTTCTGCTTCCCACACGTGTCCATA
CAGCATACCAAGAATCATTCTAAATGGTATTGAAGGATCT
GACCAAACAAATGGTGACTGTAGTTCAGATGGCCAGTGCA
GAATCGCTCTGACACGCACAGCTGTCGTAAAGGCAGAAAA
CACAACTTTTGAGTGTTCAGTAACACATGATGGTGGCACA
ACAGTGACAGCTACAAAAAGACAAAGTTCAGAATGTGTTC
ATCAAAAAATAACAGTTGAACCTGAAATAGTAGAAGTCAC
TGAGGGCATCAAACAGAACTTCACTTGTAACGTCTACCAT
TCCTGTCAGAGAGAGAATCCAACTATCACATGGAACTACG
AGAACATGCAGGTCTCAACGGGGAGCAAAATAGTTTCTGG
TTTTGATCGTGTCACCTATTCCAGCATAAGCTTTCTGGGC
ACCACAGAAGACCATGGGAAGAAGCTGAAGTGCACTGCAA
AAGTTTCTGGAAGAAACATTGAAGCTTCTGTTGCTTTACG
TGTACAATGTGTTCACCGTAACATAACGATTGAGCCAGAA
ATAGCAGAGATCACTGAAGGTGTCGAACAGAACTTCACTT
GTACCGTCCACCATTCCTGTCAGAAGGAGAATCCAACCAT
CACATGGAACTACGAGAACATGCAGGTCTCAGAAGGGAGA
CAAACACTTTCTGGTTTTGATCGAGTCGTCTATTCCACCA
TAACCTTTTTGGGTGCAAAAGAAGACCATGGGAAGAAACT
GATCTGCTCTGCAGCATTTTCCAGAGGAAATATCACAGAA
TCTGTTGTCTTATATTTGCAACACCCAATTCTCACCGTAC
TGAAGACTACTGGTCTTTACATCTTAACACCCTCACTTGT
GTTCCTCCTGGCTTGTGTAATTGCTGGAGTCATCATATGC
AAGAGGCGACACAGGTCAAAAGATGCAAGTTTTGTGTCAG
GAAGCAAACCTTTCAAACCTCACATGCCCTCACCAAAAAG
TGATCCAAAATCCATGTCTGGTAATGATTATGAAATATAC
AACAACATGGAAGAAGACCCTGACATCTATGCCAATGCCT
GATCAAAATTCAAGACATCAAAACTATCAAATGTGCTTAT
GAGGCGTTTTTAAATTGCTTACCATTGTTACACTTCATTC
ATGAAAAAATAATTCTTTCATCCATAATAAATATTTCATT
TTCATGTGCATTAAATAACATTTAAGCTTCAAATACAGTA
AATCTTTTACAGGCTAGATGTTTTATATAACATAAGCTGG
GCTATACTTTATTGAATGTATCTTTACTAATTGTGCTTGT
ATTAAAAGTGTTTTTTTTTAATACTTGACTTAAATATCCT
AATTGTTTTGTTACATATTATGTGTCATTTATTGTATTTG
TGAATTATTGGTTGCCTTTTGTTCATTTATTTTTATCTTT
TATTAAGTTTTCTAAAAGGCTGTTTAGCTATAAAACCTAT
TGTTGTGATGAGCTAATTGTTGTTATTATAGCTACTTACA
TTCATTGTTTTTTAATGTCTCAATGTAAAAAAAAAAATCT
TTACTTTTTAATTTTACTTTGTCTTTACAATAAAGCATAA
GGTTTTACATTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-380l3.4-201 Contained in:
[BAC] CH73-380L3 (1)

Genome Resources: Vega_Trans:OTTDART00000057789 (1),  Ensembl_Trans:ENSDART00000156481 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB985447 (1) 379 nt
CITATIONS (2)