Transcript

hdac12-202

ID
ZDB-TSCRIPT-131113-4434
Name
hdac12-202
Previous Names
  • hdac12-001
  • ch211-250i4.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057641 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057641|OTTDARG00000040168|ZDB-GENE-131121-613 hdac12|OTTDARP00000045162 CH211-250I4.2-001 LG_ CT027778.17 Danio rerio protein_coding NOVEL, 1451 bp
CACACCATTGGTACACACATCAAATGGGGCGGCTATGGAT
ATACTTTGTATCCCTGCGTGCGTATATTTCTAATAACATG
TATTGACGTTATTTACATATTAGTTGTTGATTATGTGACT
GCACGCGGTTTTAAAACATTACATAGCTTGTTACGTAGCA
ATGTTTCGTTTATGTCAAAAGTCTAGATGTAGAGCAGCTA
TTAAATACAATCATTTGGTTCAAAATGATACAATTCAGAA
GCAAAACCCAGCGCATTGGACATGGAGGAGGTTTTTCAAC
GCTGAACATATTTGTCTGGAATCAAGAGCACTTCCTATAG
TTCATCATGTAAAATTTATCTGTGAGCTCCCTGAAAACCA
CAGATTTCCAATGTTAAAGTTTCCCAAAATCCTGGAGAGT
TTGCTCAGAGATCAAGCCATAACGGATAAGCAGGTGTGGG
CTCCTAAGATTGCCTCAGAAGAGCTCTTGAGATGTGTGCA
CACTGAGGAGTATCTGTCCAACTTTATTAGTGGAAAAATC
AGTGAGAAAGATCAGAAAAGGAGCGGATTTCCCTGGAGTT
CTGGATTAGTGCAGCGCTGCAGATATGAAACAGGTGGGAC
GCTGTTGGCGGGACAGATCGCTCTGCAGAGAGGATTGGCC
TGCAGCACAGCCGGAGGAACCCATCATGCCTTTCCCAGCC
ACGGCTCGGGCTTCTGCCTTCTCAATGACCTGGCTGTCAC
AGCTAAGCACTTGATCTCCGAGCCCACACCCAAGAGGAAG
ATTCTCATCGTGGATCTGGACGTACATCAGGGTGACGGCA
CAGCATTCATCTTTAAGGACGAGCCCAGTGTTTTTACCTT
CTCGGTGCATTGTCAGAGAAACTTTCCTTTGCGGAAACAG
CAGAGTGACCTCGATGTCAGTTTGGAAGATGGCACTGAAG
ACAGAGAGTATCTTTCCAGAGTCCAGGAACATCTTCCTTG
GCTACTGGAGTCTTTCAGGCCGGATCTGGTGTTGTATGAT
TCTGGTGTGGATCCGCACTGGGATGATGAACTAGGAAAGC
TTCGACTCACTGATGAAGGACTTTACCGGAGGGATCTCTA
TGTGCTTCACACAGTTGTTAAAAGCGGCATTCCTGTGGCC
ACTGTCATTGGAGGAGGCTATTCCAGAGATATTGATCGAC
TGGCACGCAGGCACTCAATAATTCACAGAGCTGCATTAAA
GGTTTGGAGGGAACATGGACTTTAACTCCAGGATGGAAAT
AAAATGAGATTCAACAATCATAGAAGAAAATATTCAGTTT
AATTGTGTATGCATAAGTAAAATGTCGAGGATCTTTATAT
ACTTGTAAATGGTTTCAGTAATTTAGATATGTAATTTATG
TATATTCCCCCAATGAGGAACAAGGGAACGTTCTGCGGTT
TCATTGCAATTGATTTTATGAATAAAAATGACAGATTTTT
TCAAGAGATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations