header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4401
Transcript Name: rilp-201
Previous Names: rilp-001, ch211-209m4.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057504 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057504|OTTDARG00000040088|ZDB-GENE-100408-4 rilp|OTTDARP00000045063 CH211-209M4.4-001 LG_ CR522882.5 Danio rerio protein_coding NOVEL, 2004 bp
CAGAAAAGAAGGAGGGACAACCATCTCAAGCAAGCCACTG
TAGCTCTGTTCAGCTACTTTTAATAAAAGATCACAATGCA
AACATGCACGGTCATAATTCGCCCACATGTTCGTGACGGG
TGCGTGGATCATCAAGTTATTATCAGGTTATGACATGCAA
GTTTTCCCAACGCATAGGGACATGTCGGGTTTTATAACTC
AGTCGTGCTTATTGGAGCGTATCAACAAAAGATGTAGTTA
TAAAACAACCCGGAGCGAATATGCACGCGTTTAAAAGTGA
AACGGCACAACACTCGGACTGAAGCGCAACTGGAAGCATG
TTTAGATCCGACTGATAATTGTCGATTCTCGCTGTTTGAA
TTCAAGTTCAACTCAAGTGCATTATGGAGACTTGCGTGAT
AGCCGTCGAAGAAAACCAAAACGACACAGCCAAGGAGGCA
CATTCGTGTTTCGATAGGACATTTTCTTCTATGACGGTGG
ATGATGTGTATGAAATCGCGAAAGTGGTGGGAGCAGAAGT
GGAGAAGCTGATCGACAGCTATGGCAAGTCGAGTGTGGAA
GGTCTGGTGTCTCGCATAGTGAAAGTGCTGGAGCTCCTGG
AGAGTTTTGCAGCGAGAAACCAGTCTCATAAATGTAAAGA
AGAGGAATTGTTGAAAGCGTTCGAGACTTTACAGTTACAG
CAGCAGAAGAAACGGCATGTGAAGGAATGCGAAGAGAGCA
GCAGCAGCGCAGAGAGTCGGGACTGGCATCAGACAGAAAA
AAAACTGAAGAACAACCTAGAAGTGTTACAGTCCCAGGTG
CATCAGCTCAAAGAAGAAAACCAAGAGCTTCTGACCCGCA
TACAATGCACTCATTCAAAAGAAGACCGCACTCAGCGGCA
GGAGCGAGAGGTGATGCTCAAGCTAAAGGAAGTGGTGGAT
AAGCAGCGCGATGAGTTAAGAGCGAAGGTTCAGGAGATTT
CCAGCATGTCCAAGGAGGTGGAAGCGCTCCAGGAGCAGCA
GGAACGGTTGATGAAGATAAATGCAGAGCTCAGACACAAG
CAGAACATCATACATACACAGATGAAAAGCGCAGTGGAGA
GAAAAGCAGACCTGGAAGCCGATCTGTGCGAAAAGCAGAA
AGAGATACAGCGTCTGAACTCACAACTGGAAAGATCCAGT
GTACATACTGCTGCTGAAACGAGCAGTTCAGCCATTGACC
TTACAGATAAGATGATTATTGACTTGAAGGATCCAAACCG
GCCATGTTTTACTAAGCAGGAAGTACGAGACATGCTTTTT
GAGAGGAATGAGTTGAAGGCCAATCTCTTTCTGGTGAAAG
AGGAGCTTGCATATTACCAAAGGGAAATCCTAAATGATGA
GAGATGTCCAGGGTTTTTACTCGATGCCGTGCGCTCAGCT
ATAAAAAAGCAGAGAACCGTCATCAAGTCTAAAATGCTCG
GCATACCTGTTAGCGAATGTAGCACAGATGAGACAGACGG
GCCTTTGTTTGAGAGAAGTGGAAATGAAGACAATGATACA
GACAGCACTGACAGCAGGCCGCAAGAGTCACGCATCAGAA
ACCTATTTGGTTTCCTGACGCGGCCCAGTCTCACCAGGAG
TTCGGTTTCCCCGTCATCCAGCCTTCCGGCATCCAGTTCT
ACGTGGGAAATCATTGATCCAGATGAGCAGGGAGTCGAGG
AGGAGGCAGAAACCCTCAGCTCCTCTTGAGAAACATCCAT
CTATCACTCATCGTCTGTGAAAGAGAAGTTTCAAATATGT
TCTTTTAGAATTCAGACAAAGGAATGGATCAACGATTGTA
TTGAGAGAAACAATAGCTACGTATTTGGCTATGCAAAAAT
GGTATTTTAATGTGTTTTGCCATTTTTACTCATAGTACAA
AATAACTTGGCACTTTTGTTAATTTAACCAGTAGTTAGAT
TCGTGGCTGATGGTCACACATAAAGCCTGGTTTATACTTC
TGCGTCGAGTGATCAGCGTGACCTACAGCGCATGGTTTGC
GCAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rilp-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057504 (1),  Ensembl_Trans:ENSDART00000112967 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EB893763 (1) 524 bp
GenBank:CD586409 (1) 347 bp
CITATIONS (2)