ZFIN ID: ZDB-TSCRIPT-131113-4345
Transcript Name: phldb1b-202
Previous Names: phldb1b-005, ch211-136c24.1-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057173 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057173|OTTDARG00000039859|ZDB-GENE-121114-8 phldb1b|OTTDARP00000044833 phldb1b-005 LG_none BX901923.6,CR848783.10,CR385077.11 Danio rerio protein_coding KNOWN, 774 bp
GGAGATGACTTTTGTCCAGTGCTGACCAGGAGAATCTGCT
TTGTGTCTGAGCGATCACACACAGCATCTCTATTCCATTC
TCAAAGCTCTTTCCAGCTTCATAATGTCTTGTCCATGAGG
AGCCATGTTGAGGGTCTTGTTTCATTGGCTGCCAGAAAGT
TATTGCAGGATTCTCATGTCCCCGAGCAAGTAAGTGACAG
TACACTGGCCATGGATACTTTGAACCAAAATCTTAGCCAT
GGGCATCAGTCTCATCAGGTGCTCCAGACCATCAGCCAGC
AGCTCATGCAGGACAGAGCTCAATACCACAGCAGTGTCGC
CAAGAGAAAGGAAAAGGTGGTGGCATTGGAGAGCCAGGCG
AGCCAGCTGGGAATACAGGCCGCTCAGGAGTGTGAGAGAC
TGGCCAAGGACAGAACCATCACCTTGCAGATGCTACACAA
GGAAAAGGAAAGGCTGGCCAGTCTGGAGAGAAGATACCAG
AGTTTAACTGGTGGAAAGACGTTCCCCAAAAGCTCCAATA
CTATAAAGGAGGTGTACAGATCTCGACTGGACAGTGATTG
CAGCCAATCCTCACTTAGACCGAAAGTCAGCGCCGGTTTG
TCTCCTACATACACGACGGCCACGCTGGGACGAAACAGTC
CTGCCAGGAGTCCTCTGATGGTGGCCAACAGCACCGGAAG
TCTCCCACGCAACCTGGCAGCCACCCTGCAGGACATCGAG
ACCAAGAGACAGCTGGCTCTTCAGCAGAAAGGTAACAAGA
GACACGGATCAGAA

phldb1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA phldb1b-201 (1)    Ensembl 5369
phldb1b-202 774
phldb1b-205 (1)    Ensembl 801
ncRNA phldb1b-003 (1) 693
phldb1b-004 (1) 739
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
phldb1b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057173 (1),  Ensembl_Trans:ENSDART00000153848 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)