ZFIN ID: ZDB-TSCRIPT-131113-4292
Transcript Name: si:ch211-235m3.10-201
Previous Names: ch211-235m3.10-001, si:ch211-235m3.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056981 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056981|OTTDARG00000039732|ZDB-GENE-131127-468 si:ch211-235m3.10|OTTDARP00000047262 CH211-235M3.10-001 LG_ CR382327.27 Danio rerio protein_coding PUTATIVE, 6218 bp
TGGCATCAAAAATCAGGACAGTCCTGCAATTGATTATTGA
TGTGTTTCTGATGCCAATGTTAGCTGTCGTTTTGACATCA
GAGCAGTTTCACCAGTTGACTGAATCTATTTACAATATTT
ATGGCTTTTTTAACGTATTTTTTACGTCAATTTTGACATC
AAGAAACCATCTGGGAAGGACAAGCTCACGGTTGACTTTT
CCATCCTAGATTTGTTGCCGCTTGTTGACTGACCTGATCA
ATATTTCAAGCTCCCATGCAGGAGCATCGGTTACCACCTA
ATCTTTTGCAGATCTTCATCTCAGTCCGATGACAACCTAA
TTGCCTGACTGTCTGCTCAGAAGAAAGAACATTCACCAAG
ATATTTCACATAGACAAGAGATGCGTCTATATTGTCTCGC
TTTAAGCTCTCTCTCAGCTCTGTGTGTATTGTTGCAGCTC
AGCAAGGAAACTCGACACTCGTCTGTGATTAATAAAACAT
CACCCCGAGGGCCGAAAGGCACAACTACCCGAATGCTTTC
AGCTGTATAAGCGTTGAAAGGCGACATAATCTCCCAGGGA
CAAGATTTGGGCTGAGATTGAAAGAGGTCTAGTATAAGTT
GAACTCTTCATGCTGCACTCAGATCAGCGGCGGATGGGAA
TACGGAGAGCATGGAGAGCGGACAGAGCTTGACGCGGGTG
ATCTCAGAAATGCAGAATGAAATCAGAAAGCTGGAGAATG
AAAACAAAGAGCTCCGTGGGCAGCTGGACCGGCCGGATTC
CTGCGCATTATCAGCTTCGCCGCAGGAGAGCTTGTTTCAC
GCTAACCTGAGACGCAATGTGTCTGCGCCGGATCTTGAAG
GACAGTACAAAGAAAACATTATCATGACTGTGCGGAGATA
CTCCATATCGGCAAACTCCATTAATGGCTCTCGGAAGAAT
GAGATTTTACACAAGCCAAGGAGATACGAGGAAACTGTAA
ACAATAAATGGGCAAAATTACATGATGGTTCTCCAGGGCG
TCCTACTAGTGCCTATGCTAAACCAGACATGGAGAAATTA
ACCAACAGACATTCCCTTCAGGAGTACGTCAACAAAAACA
GAGTCAAAGTCAAGACGGTCACTTTCCTGTTGCCGGTAGA
TGATATTTATACCAATCGCCCTGCCCTGGCCGAGCAGCTG
CCTGAAAGGAGCACCTGTGAACTCAAAACAATTGATGAAA
CCGACTCGTGAGGTGCTGGAAAACCACAACCAAATGGATG
TTCGGGAAGCTCACATTGAAGCGAAAACTATGCCACACTC
ATTAAAGACATTTTGTCCGAGTCCTGTGGAGAATTAATAC
CTACACCTGACCTCAGCACTTCGACTCCTGTTACAGATTT
GGTTTCTGAAATTCATCCAGCTGAAGAAACACAAGTCACC
TCATAGTGTCGTCCGATGGCCTGTCAATCACGCTATGGTG
TTTGGATCAGGTGTCGGTACAAACGGTGGAGACATTCATG
GAGACATTCACTTCCCGCCCACTACAATGCACGTTCTACC
AGTTCACAGAATCTCCTATTGTTTTATTAAGAGTTAGATT
GCCTTATTTTAACAGTTTCTTTATGAACATTTAAAGGTGC
AATAGGAGATCTTGGAAAATGCTAACATTAGCCTGATAGC
ACTGAGAGCTATAAGTCCCTGCTGATCCTATAATCTTAAA
TGTGCATGAAAATCTTCAATTTAAAATGTATTTTCCTACA
AGAAAGAGAAGAAAAAGAGGCCAAAAGAAGGTGTACACAT
TATTATTTTGCTTAGATCAGGGAAAATCTGCAGTCCAGAG
GCTGCAGTTGAAAACATCTTTTCCCCAAATGATTTATGCG
GTCACATTTAAAGATGTTAAAGTCGGCATGAAATCAGAAT
TTACTCTTTTTTTTCATATTTATATAGTGCTTGTTATGAA
TGATCTATCAGGCAATTTGAGCTAATTGGGGTGGGGCTAT
CAGTCCTTTAAGCAATCAGTAATTTGGGGCGGGGCTATCT
GTCATTTAGTGTGGGTCTATTAACCCCTTTAGGGCGTAAC
TATTAGTTGTTTGGAGCGGGGCTATCTATCCTTTAGAGCA
GGGATTCCCAAACTTTTTTATTCCGGGACTCAACACCAAG
TAATTCAATCTCAAGACCCACCATAATATTTTAATATGGA
AAAATGGGTAAAAAAAAAAATGTATCCATTCAAAGCAGTC
AAAAATATATGGTGTGTGGCTTTTTGGATTTTGCGATTTG
ATATGCATAAAATGAGGCTCGAACTAGTGTTTAAAATAAA
ACACGCAGGACGGAGCAAAAAAAGCTCTATTAAAAGCAAG
TAATTTGGGGCAGGGCTATCTGTCATTTAAGGTGTGGCTA
TCAGTAATTTGGGGAAGGGCTATCTGTCATTTAAGGTGTG
GCTATCAGTAATTTGGGGCAGGGCTATCAGTCATTTAGGG
TGTGACTATCAGTAATTTGGGGCAGGGCTATCAGTCATTT
AGGGTGTGACTATCAGTAATTTGGGGCAGGGCTATCAGTC
ATTTAGGGTGTGACTATCAGTAATTTGGGGCAGGGCTATC
AGTCATTTAAGGTGTGACTATCAGTAATTTGGGGCAGGGC
TATCAGTCATTTGGGGCGAGCTATCTGTCATTTGGGGTGT
GATTATCAGTCATTTGGGGCAGGGCTATCTGTCATTTAGC
GTGTGACTATCAGTAATTTGGGGTGGGGCTGTCCTTCCTT
TAGGATGTGGCTATAGGTCATTTGGGGCAGGGCTATCATT
AATTTAGGGCATAACTATCAGTCATTTAGGGTGTGACTAT
CAGCCCTTTAGGGTGGGGCTATCGGTCTTTTATGGCATGA
CTATCAGTCATTTGGTGTGGGGCTATCTGTTTTTATGTCA
TGACAATTAGTCATTTGGGTGCGGGTCTATCCTTCCTTTA
GGATGTGACTATCGGTCATTTGGGGCGGGGCTATCATTAA
TTTAGGGCATGACTATCAGTCATTCAGGGCGTGACTTTCA
GCCATTTAGGGTGGGGCTATTAGTCTTTTAGGGCGGTTAG
GACACGTCTATCAGTTCTTATGAATGATCTATCAGGCAAT
TTGAGCTAATTGGGGTGGGGCTATCAGTCCTTTAAGCAAT
CAGTAATTTGGGGCGGGGCTATCTGTCATTTAGTGTGGGT
CTATTGACCCCTTTAGGGCGTAACTATTAGTTGTTTGGAG
CGGGGCTATCTATCCTTTAGACCAGGGATTCCCAAACTTT
TTTATTCCGGGACCCACCTAGGTAATTCAACACCAAGTAA
TTCAATCTCAAGACCCACCATAATATTTTAATATGGAAAA
ATGGGTAAAAAAAAAATGTATCCATTCAAAGCAGTCAAAA
ATATATGGTGTGTGGCTTTTTGGATTTTGCGATTTGATAT
GCATAAAATGAGGCTCGAACTAGTGTTTAAAATAAAACAC
GCAGGACGGAGCAAAAAACTGTCAACTGACGGGCTATCTG
TCATTTGGGGCGAGCTATCTGTCTTTTAAGGTGTGGCTAT
CAGTAATTTGGGGCAGGGCTATCAGTCATTTAGGGTGTGA
CTATCAGTAATTTGGGGCAGGGCTATCAGTCATTTAAGGT
GTGGCTATCAGTAATTTGGGGTGGGCTATCAGTCATTTAA
GGTGTGGCTATCAGTAATTTGGGGTGGGCTATCAGTCATT
TAGGGTGTGACTATCAGTAATTTGGGGCAGGGCTATCTGT
CATTTGGGGCGAGCTATCTGTCATTTGGGGTGTGACTATC
AGTAATTTGGGGCAGGGCTATCTGTCATTTGGGGCGCGCT
ATCTGTCATTTGGGGTGTGATTATCAGTAGTTTGGGGCAG
GGCTATCTGTCATTTGGGGTGAGCTATCTGTCATTTGGGG
TGTGACTATCAGTAATTTGGGGCAGGGCTATCTGTCATTT
GGGGCGAGCTATCTGTCATTTGGGGTGTGACTATCAGTAA
TTTGGGGCAGGGCTATCAGTCATTTAAGGTGTGGCTATCA
GTAATTTGGGGCAGGGCTATCAGTCATTTAGGGTGTGACT
ATCAGTAATTTGGGGCAGGGCTATCAGTCATTTAAGGTGT
GACTATCAGTAATTTGGGGCAGGGCTATCAGTCATTTAAG
GTGTGGCTATCAGTAATTTGGGGTGGGCTATCTGTCATTT
AAGGTGTGGCTATCAGTAATTTGGGGCAGGGCTATCAGTC
ATTTAAGGTGTGGCTATCAGTAATTTGGGGCAGGGCTATC
AGTCATTTAGGGTGTGACTATCAGTAATTTGGGGCAGGGC
TATCAGTCATTTAAGGTGTGGCTATCAGTAATTTGGGGCA
GGGCTATCAGTCATTTAGGGTGTGACTATCAGTAATTTGG
GGCAGGGCTATCAGTCATTTAAGGTGTGGCTATCAGTAAT
TTGGGGTGGGCTATCAGTCATTTAGGGTGTGACTATCAGT
AATTTGGGGCAGGGCTATCTGTCATTTAAGGTGTGGCTAT
CAGTAATTTAGGGTGGGCTATCAGTCATTTAAGGTGTGGC
TATCAGTAATTTGGGGCAGGGCTATCAGTCATTTAAGGTG
TGGCTATCAGTAATTTGGAGTGGGCTATTAGTCATTTAGG
GTGTGACTATCAGTAATTTGGGGCAGGGCTATCAGTCATT
TGGGGCAGGGCTATCAGTCATTTGGGGCAGGGCTATCTGT
CATTTGGGGTGTGATTATCAGTCATTTGGGGTGGGGCTGT
CCTTCCTTTAGGATGTGGCTATAGGTCACTTGGGGCAGGG
CTATCATTAATTTAGGGCATAACTATCAGTCATTTAGGGT
GTGACTATCAGCCCTTTAGGGTGGGGCTATCGGTCTTTTA
TGGCATGACTATCAGTCATTTGGTGTGGGGCTATCTGTTT
TTATGTCATGACAATTAGTCATTTGGGTGCGGGTCTATCC
TTCCTTTAGGATGTGACTATCGGTCATTTGGGGCGGGGCT
ATCATTAATTTAGGGCATGACTATCAGTCATTCAGGGCGT
GACTTTCAGCCATTTAGGGTGGGGCTATTAGTCTTTTAGG
GCGGTTAGGACACGTCTATCAGTTCTTCCAACACAATCTC
ACGGCAATTCGTAACTTTTTCATTTAGTGGCCAATTCGTA
CGAATTCGTAGGATTTAATTTGTACATTTTAGTACGATTT
GCTCATCCCCCAATGACGGTTGGGTTTAGGGGTGGGGTTA
GGTGCCACGCCTCCTTTTTAAAATCGTAAAATTTCTTACG
ACTGAACTACGAATTAGCCACTAAACTGCCAAAACGTAAA
ATACTTACGTTTTCTCATGAGATCAGGCTGGTTCTTCAGG
GTATTACAATAAGTCATTTTGTGCGGGTCTATCAGTGCTT
CAGAGTGGGGTTATCAGTCATTTGGGGCAGGTCAATCAGT
AATTTAAATGAATTTGGGTGGGTCTATTAGTAATGTAATG
CCTCATTTCTGCCTTTCATCATGGTAGGCAGTTCAAAAGA
ATATGCTCAGATTTTGTCTGTAAACTTACAGTAATCCTCC
ACATCTGAGAGCAAACTGCCATTCAAATCTTCCTTTATTT
TGTTAGCTATGCCCATCCTCCAAAAATCCAATCATTTTCC
AAAGGACAGAACTATGCACTGCCCTACATTTATTTCTCAT
TTCAGAAAATGTTTCAATCAGATGTACGTCATGATAGAGG
GGAAAAAAGGACAATCTTAACTTCAGTTTCATGCCGACTT
TAAGTTCTTCTCAGGAGTTGCCAGTTCATTTCCTTTAGGT
TTTGTTTTCCTTTCACCTAGAGGTAGGATTAGAGATATTT
AACTTATAGACTATTAGCAATATCTGAGGGCATGACCATT
AGCTTGCCTAAGATTGGCATTTTACATATTACCAGCTCAT
GCCATTATATTAAACACAATAAATTTACAGTAAGATAAGT
GATACAACTAGGCTCCAGAAACAGATCAGAATAGCAAACA
GAACCGAGTGTGAACACGTCTGTTGGGATTATCAGTTGAA
GATTTCTTATTCTCAGTCTTGCTGGATGTTATCTCTTCTG
TTCCTTTGTCTGAAGGTTCGTCCGAAGAGCTTTTATCATT
GTAAAGACTCTCCGAATCCTGTGGTTTATCTGTAAGTGAA
CATGTTACAAGCTAAATCAGTGTTACTATAAAAAAAATCT
TCATTTTATTTGTATCATATTTCTGTTTACGTAAATGGGA
ATATATAAATGTGTATTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-235m3.10-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056981 (1),  Ensembl_Trans:ENSDART00000157159 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH550399 (1) 1016 nt
GenBank:EH571525 (1) 907 nt
GenBank:EH568758 (1) 788 nt
CITATIONS (2)