ZFIN ID: ZDB-TSCRIPT-131113-4291
Transcript Name: si:dkey-14f6.1p-001
Previous Name: dkey-14f6.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056978 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056978|OTTDARG00000039729|ZDB-GENE-131127-576 si:dkey-14f6.1|no_translation DKEY-14F6.1-001 LG_ CR382327.27 Danio rerio unprocessed_pseudogene none, 656 bp
ATGGCTTCAGCCGGTTTGGAGATATTGGGGATGATCCTGA
CCGTGGCCGGCTGGCTCGGGGTTATGGTCGCCTGCTGTTT
GCCCATGTGGAGAGTGGCTGCATATATAGGCCAGAACATA
GTCATCACGCAGATCGTTTGGGAAGGTTTGTGGATGAGCT
GCGTGGTGCAAAGCACGGGACAGATGCATTGCAGGGTGTA
CGACTCCATGCTTGGACTTCCAGATGACTTGCAGGCTGCC
CGCGCGCTTACCGTTGTAAGTACACTGCTCGGTGTGGTGG
GTATAGCGATGTCCGTGGCTGGAGCGAAGTGCACTAACTG
TACGTCAGATCCAGCAAGCAAACCGCGTATAATAATGGCA
GCCGGGGGCACGTTTATTTTGTGTGGGCTACTACTGTTAG
TTGCCGTCTGCTGGACAGCCAATGGCATCGTTATGGATTT
CCACAACCCGCTAATGGAAGATAAGCAGAAGAGGGAGTTT
GGGAACTCGCTGTATTTCGGATGGGGTGCGTCATGTCTGC
TGATACTTGGCGGAGCAATTTTGACGTGTTCGTGCTCTTC
GAAAGCGCGCGGAAATGCTGCGCCGTCAAGGGTGGAGTAC
TCTGGGGTCAAATCCCTCTCTGTCAACGGATATGATAGGA
AAGACTATGTTTGAGG

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-14f6.1p-001 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056978 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)