ZFIN ID: ZDB-TSCRIPT-131113-4290
Transcript Name: ppp5c-202
Previous Names: ppp5c-001, ch211-235m3.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056975 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056975|OTTDARG00000039726|ZDB-GENE-050327-75 ppp5c|OTTDARP00000044705 CH211-235M3.4-001 LG_ CR382327.27 Danio rerio protein_coding KNOWN, 1289 bp
GTGACCAGATGGGGAATAAAGGAGCGTACATTCATCTCAG
GGGATCAGACCTCAAGCCAGAGTTTCACCAGTTTACTGCT
GTGCCTCATCCAAATGTCAAACCGATGGCATACGCCAACT
CCCTGATGCAGATGGGTATGATGTAGAGGTTTTCTCACAC
AGAAGCTGCTGTGGTCTGAAGACACCGGCCCTCCAGGACT
GAGTTTGGACACCCCTGCCTTGAATAGATGTCATCCTTGG
GTTGATACCCCCTCCTTGGTCATTAGGTGTTCATGTGAAG
CTACACAGTTTGAATCGGATGATAATAAAACTAAATTGTA
CCAAAGAACAACAAATATATATGTGTAGCGTCACAAAATA
AGAGCGCTCATGTAGAATTACAGCTCCTGCGACCATGCGG
ATCAAAACCCTGATCAACACTTTACAAAATCTGTGTTTCT
ACATGAACCTTTCGTTTGCCCCGTGAATACATCGCAGGAC
CGTTTCCTTTACATTTAGTGAAGTGTTGGGAGGGAGAACG
GTCATTAATACTGTAGTAGTATAGATATTAACGTGTCATC
TGTTCACATGAGGAAAAGAAAAGCAACGTATAATAAAGAA
ACTCCACGCACAGCATCTGTCTTGCAGGCTAGGGTTTCTG
TTTGTCCAACCTACATGATAAATGTCACAAAACAAATTGA
GCTGCTGTGTAAAACTTCCACGGTTTTCCTTCACACACTC
GCTCCCTTTTAAGAAGGATAGAACAGTGTGATATTATTAA
GCTCGGTCTCTTGTCTCCACTATGTAGGCAGCTCCCACGG
TTATTCGTTTTTCTCCCAACATGCTTAACTGAAGTGCACT
GGAGATTCTCTATATCAGTGTTTCTCGACCATGTTCCTGG
AGGACCACCACATTCTCCTTGTCTCCTCAACCGAACACGC
CTGATTCAGATCATCAGCTCGTTAGCAGAGACTGAAAGAC
CTGGGTGTGACGAACACACACACGAACATGCAGTGCTGGC
GATCCTTCGTGGAACGTGGTTGAGAAACACTGCTCTATAT
CCATTTTTTTTATTTCCGTTTAGCAGATCTCCCTTTTTGT
GTGTGTGTATGTGTGTGGACTTCCAGCAGAATCCTACCTT
ACTGTCTCTTTAAACGCACAGCAGTCATGACCCCACGCCC
CTTGACTTTTTAGAGGATATCAGTATGTACACCAACATGT
ATGTATATATACTTTATCATTTGAAACTTCTGTGTACATG
TTTGGAAAAGACAAGATATTGAATAATAAAACAAATATGC
CAGTCTGAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp5c-202 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056975 (1),  Ensembl_Trans:ENSDART00000153853 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC129287 (1) 2620 nt
GenBank:EV604980 (1) 466 nt
CITATIONS (2)