Transcript

im:7143333-201

ID
ZDB-TSCRIPT-131113-4268
Name
im:7143333-201
Previous Names
  • dkey-7i4.18-001
  • im:7143333-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056906 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056906|OTTDARG00000039670|ZDB-GENE-041111-186 im:7143333|OTTDARP00000044643 DKEY-7I4.18-001 LG_ BX004964.9 Danio rerio protein_coding PUTATIVE, 596 bp
AGTGACGTCATCAGGCGGCGGCGCACTCCTGTTTGTTGTG
AATCTACTCGAGAAAGAACAGCAGATTATTATAAAGATGG
CGTTTATTAAAGAGGAGAGTGAAGACATCAAGATTGAAGA
AACATTCACAGTCAAACAGGAAGACATTGAAGATATTTTG
AGAGTGAAACATGAAGAGATTGAAGAAACATTTACAGTCA
AAAAAGAAGACCCTGAGGAACAGACAGACCCGATGCCATT
CAAAGAGGAGAGTCTAGATCAGAATGAAGTAGAAGAGAAG
GATCTTTATGAAGGATGTCGTGACTTGAATCGGAACAGTC
GAACACCCCCTCCTCATGGAAAAAGAGCCCAGAAAGCTAA
ACCCTACACCTGCCATCTCTGCGGGAAAAGTTTCACGCGG
AAAAAGATCGTTACAGACCACATGAGGCTTCACACTGGAG
AACGGTTTTACGATTGTCAACATTGCGAAAAGAGTTTCGC
TTGGGAACAAAACTTTAGGCACCACATGAGGATTCACACT
GGACGAAAACCTTACGTCTGCCAACAGTGTGGAAAGAGTT
TCACTTGGAAACAAAACCTTAGAGAGCATGTGATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations