Transcript

si:dkey-261m9.9-001

ID
ZDB-TSCRIPT-131113-4233
Name
si:dkey-261m9.9-001
Previous Names
  • dkey-261m9.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056757 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056757|OTTDARG00000039548|ZDB-GENE-030131-5087 si:dkey-261m9.9|OTTDARP00000044519 DKEY-261M9.9-001 LG_ CR762436.8 Danio rerio protein_coding NOVEL, 312 bp
ATGTCTGGAAGGGGCAAAGGCGGTAAAGGACTCGGGAAAG
GAGGCGCTAAGCGTCACCGCAAAGTTCTCCGTGATAACAT
CCAGGGAATCACTAAGCCTGCCATCCGTCGTCTTGCTCGC
CGTGGTGGTGTGAAGCGTATCTCCGGTCTGATCTACGAGG
AGACTCGCGGTGTGTTGAAGGTGTTTCTGGAAAACGTGAT
CCGTGATGCCGTTACTTACACCGAGCACGCCAAGAGAAAG
ACCGTGACCGCAATGGATGTTGTCTACGCTCTGAAGAGAC
AGGGACGCACTCTGTACGGCTTCGGCGGTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations