ZFIN ID: ZDB-TSCRIPT-131113-4200
Transcript Name: lmod2a-201
Previous Name: lmod2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056639|OTTDARG00000039456|ZDB-GENE-040912-41 lmod2a|OTTDARP00000044424 lmod2a-001 LG_ CU457815.12 Danio rerio protein_coding KNOWN, 1058 bp
CAGCATAGGACACTAATCTCCTATACAAGTATTGACAAAG
GCAGAGTAAAACTTCAATCACACAAAGGATTTATAGAGTT
ACAACTATGAGCACCTCTGGGTATAGAAAAGGGCTTGGCA
AGCATGAAGAGATTGAAGAAGATGAACTTTTGGCCTCACT
TACCAGCGAGGAGCTCCAGGAGCTAGAGAAAATAATGGCT
GAAATGGAACCTGATGAGAACATACCCATTGGGCTACAGC
AAGAAGACCAGACAGCCAAAAAGTCAACGGGAACATTTTG
CAGAGGGTCGTTGCTGAAGTACTGGGAGGACGAGACTCAA
AGATTGTTAAAGGACAGCATGGATGAGTGCCAGACAGATA
AGTGCGAAGAGGAATGTGCCAGTGAAGAGCCGGAGGATAA
TAAAGAAAAGGGGGGTGACAGGGTGAAGCAAGCTAGGTCA
AACAAATGGAATTCTGTGGAGCTATCACGACTAGATAGCG
AGAGCGCTCGAAAATATAATGATGCCCCCCACTACCCTGT
TACACTGGACGGGTCAAGTTGTAACCCCACTGATATCGAT
AAGACTTTAGAGCACGTATTGAGCAATGCCACTTCCTTGA
CTGAAGTCAACCTTAACAATGTTGAAAACTTATCCCAAGG
TGTTTTGGTGGGCTTTGCTGATGCCTTAACCTCGAACACT
CATGTTGAGGTTTTCAACCTTGCCAACACCCATGCAGATG
ATCAAGTAGCTTTGGCCTTGGCCAAAATGCTGAAGGCGAA
TAGTAGCATTACCAGACTTAATGTCGAGTCCAACTTCATT
TCAGGCAAAGGCATCTTAGCTTTGATTAAGTCACTTCAGT
ATAACAACACACTGACTGAGCTCCGATTCCACAACCAGAG
ACACATCTGTGGAGGCCAAGTAGAGATGGAAATGGTGAAA
CTGCTAAAGGATAACACTAGCCTATTGAAACTAGGATACC
ATTTTGAGTTACCCGGCCCAAGGATGAGTGCAACTGGTAT
ATTAACCCGCAATCAGGACCGCCACAGGCAAAAGCGGCTC
CAAGAAAGAAGAGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lmod2a-201 Contained in:
[BAC] CH211-12K12 (1)

Genome Resources: Vega_Trans:OTTDART00000056639 (1),  Ensembl_Trans:ENSDART00000067106 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC081475 (1) 1061 nt
GenBank:CN021846 (1) 914 nt
GenBank:CN013796 (1) 819 nt
GenBank:EB897949 (1) 622 nt
CITATIONS (2)