Transcript

tsg101a-201

ID
ZDB-TSCRIPT-131113-4193
Name
tsg101a-201
Previous Names
  • tsg101-001
  • tsg101a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056618 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056618|OTTDARG00000039441|ZDB-GENE-030217-1 tsg101a|OTTDARP00000044407 tsg101-001 LG_ FP236788.10 Danio rerio protein_coding KNOWN, 1898 bp
AAAACCCTCACTGTAATGACGCTTCCACCGTTCGTCTTGT
TTATCTTCTTCGACATGAATGCTAGTCTTCATTGCTTTAT
TTTATTGAATTCTCATTAAGCAATTGCATTTCCGAATAAT
TTAGTGTGTTATTAGTGTGTTTATAGGGTTTTGAGACATA
CTATTTGACTGATTACGAGCGTTTTAGGGTTTGTCAGAGT
TGTTTGGCCTGAGCTTAGAGACTCGCTTATTTCACATTTC
GGGCGTTTAATCTTTTTTTTCTTTAGAGTTTAGTGTGTTT
AATAATAATCCATTGTTAAACCATGGCTGTTGTCAACGAA
GGAGCTCTTAAAAAGATGCTGAAGCAATACAAATACAGAG
ATCTCACTGTGCGAGAGATAACAAATGTCATATCTCAGTA
CAAAGACCTCAAACCTGTTATGGATGCATATGTATTTAAT
GATGGATCCTCCAGAGACTTGATGAGCCTCACAGGAACTG
TACCAGTTAGTTATAGAGGGAATGTATACAATATTCCTGT
GTGCTTGTGGCTTTTGGACACATATCCCTACAATCCTCCT
ATATGTTTTGTGAAGCCCACCAGTGCGATGATGATTAAGA
CAGGGAAACACATTGATGCCAACGGCAAGATCTACCTGCC
CTACTTGCATGAGTGGAAACATCCTCAGTCAGATTTATAT
GGACTTATCCAGGTCATGATTGTTGTTTTTGGTGAAGAGC
CACCCGTTTTCTCCAGACCCACCACACAACCTCCATATCA
GGCTTTCCAAGCGACTGGACCTCCAAACCAGTCTTATATG
CCAGGCATGCCAGCAGTATCTCCCTACGGGCCCAACCAAA
ACCCATGTGGTTACCCAGGTTACCCTTACCCAGGAGGGAA
TGCTTATCCTGCCACAGGTGGCCCATCACATTATACTTCC
CAGACTCCAGTCACTACTGTGGGTCCAAGTCGTGACGGCA
CCATCGGTGAGGACACCATTCGAGCATCACTAATCTCAGC
TGTGAGTGACAAACTACGCTGGAGAATGAAGGAGGAGATG
GACAGAGCACAGGCCGAACTAGATGCCCTAAAGAGGACAG
AGGAGGACCTGAAGAAAGGACATCAGAAACTGGAAGATAT
GGTGTCCCGTCTGGACCAGGAAGTGGCTGAAGTGGACAGA
AACATTGAGCTTCTCAAGAAGAAGGATGAAGAACTGAGTG
AAGCTCTTGAGAAGATGGAGAATCAGTCAGAAAACAATGA
TATTGATGATGTGATCATACCAACAGCCCCGCTCTACAAA
CAGATCCTGAACCTGTATGCAGAGGAGAATGCAATAGAGG
ACACCATCTTTTACCTTGGAGAAGCCTTACGTAGAGGAGT
CATCGATCTGGAGGTCTTTCTCAAGCATGTGCGCCTACTG
TCCCGAAAACAGTTTCAGTTGCGAGCACTTATGCAGAAAG
CACGAAAGACTGCTGGACTTAGTGATCTATACTGACCACG
TCACCACCAATACACTCTCCCCAACACTCCAGCTCTGATC
ATAAGACCCAGACTCTCTTCTAATCACTTTGTGGCATGTC
AGTGGACGTTCACCTGTTTATCATATTTTACTTTTCTGAG
AATTTTAGATGCTGTGCCTGCCTGATTTTAATCTCTTGAT
TTAGAAAAGGTACAAAGGTACAGTGTTTGAGTAGACCTGA
ACATTCGAAGTCAATGGGATATTATGTTCCTTCTTTCATT
TGAGCTTCTAATGTTAAACTGGTAGGTGTTTTGCGTTTAG
ATGCTACTGCTATTGACTATACAGATTAATATTTAATTTC
AGGGTCAACAGGAAATGTATGAGATCAGGCAATGTTACAG
ATTATTGTCTTACTCAATAACTGTGAATCTCGCAGGGAAA
TTTACCCCAATTAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations