header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4163
Transcript Name: cecr2-201
Previous Names: cecr2-001, ch211-276c7.3-001, si:ch211-276c7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056483 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056483|OTTDARG00000039337|ZDB-GENE-131121-533 cecr2|OTTDARP00000044291 CH211-276C7.3-001 LG_ BX004976.7 Danio rerio protein_coding NOVEL, 7530 bp
CTCCCCGCGACCGATGGTATCGCCCTGCCCATCTGTTCTT
CTCCTGTGAAATGCGGATTGAAACAGATTGAACGATTCTA
CGGGTCGCGATGGCTACTGCGCCGCAAGGACAACAAGTTT
TGCTGTTCAGTTAAACAAGTTCTATGTAAGGGAAAAGCCG
GACGGATTCGTCTAAGACACACTTTTTAATGTAAGACACG
CGTTGGATAACAGGAAAATGTCCCAGGGATGTATAACTTC
AGCGGAGGAGATCCAGTCTTGGTGGGAAGTCCCCGCCATA
GCGCACTTCTGCTCTCTCTTCAGGACGGCGTTCAATTTAC
CAGACTTTGAAATCGAGGAACTGGAGCAAGCACTACTGAA
ACAAGACCAAGATTTCCTCTCAGTTCTTCTCTGCTCCCTG
CTAAAAGGATGTTACCAGCGCAGCGACATCACGATCCAGT
CATTTAGCGGTTACCTGGAAGATATTATCAATTACCGATG
GGAACTAGAAGAAGGAAAGCCCAATCCACTGAAGGAGCAT
CCATTTGAGGAGCTACCAACCCGCACACAGGTGGAGCTTT
TGCACAGACTCTGTGACTATCGCCTTGATGCTGCTGATGT
CTTCGACAGGCTCAAGGGCCTGGATTCAGACAGTTTGCGT
GTTGAGCCTCTGGGCCAGGACGGGAATGGAGCCCTCTACT
GGTACTTTTACGGTACAAGGCTATACAAAGAGGAGCCAGT
CGAAGTGGTGTCTCCCCAATACAGTAACGATAAAGCTTCT
GAGAAGAAAAGAAGAGGAAGGCCTCCAAAGAATAAGCCAG
AGGACATTGATTTATCAGTGGTGGAGGAGGGGGTGAACTC
TGTCAAGGAAGAGTACGAAAGGGTTGAGGAAACTAAACCT
GCGATTGAGCGTGAACGTGGGGCTTGGTCTGTCATTTGTG
AGACAGAGGAGCAGTGGCTCAATCTGGCCGAAAGTATTAA
GGACAAGATCTCTCCTCAGGACCGGCACCTGCACCGCATC
ATCACTCAGAACTTCTTACCTGAGATCAGTAACATGATTG
AACACAAGGAGAAAGAGTTAAAGCAGAAGCTACTGAATTC
GCCTAAGGAACACAACAGCCAATCTGAACAGCATAGCAGC
AAAGACAATTGGCAGATGCAAGCCACAACTGAGGAGGAGA
GGCAAAGGGATGAGGACCTGGAAAGGCAAGTCCTACTTGC
TGAACAACGGAAAGAAGATGAGAGACTCCTTCAAGAAGAA
CGGGAGCGAGAAGAACAGGAGCGAGTCAAAGCTGTTGAGG
AGCGTGCCCGTAGAAGAAAGCAGAGGGAGGAGAAAGCCTG
GTTGCTCTCTCAAGGGAAAGAACTTCCACCTGAGCTGCTT
AATCTGGAGACTCACTCGCCTATTCGCAGAGCACGTCGCA
CCAAACAGTTTTATGAGATAGATGACGACTACACTGCTCT
CTACAAAGTTTTGGAGGCCCTGAAAGCTCACAAAGATGCC
TGGCCATTTATGGAACCTGTTGATGAGTCTTACGCACCTA
ACTATCATGAAATTATACAGACCCCAATGGACCTGTCAAC
TATTGAAAGGAAGCTGAATGATGGAGAGTACCTTGCTAAG
GATGAGTTTGTGGCCGATGTAAAGCTTATGTTTGGGAACT
GTCTGGAATACAATGGAGAAGAGAGTGAATACACAATAAT
GGCTGAGTCCTTGGAACGCTGCTTTACCCGAGCCTTACTG
AAGCACTTTCCATCTGAAGATGGCGACACTGATGAGGAGT
TTCATGTGAGCAGTGAAGACCGCAAGGACAAGAAAAAGAA
CAAGAATCACAAACAGTCAGGTCCCGAGAGCTTGATCAGA
GCCACTGAGCAGGTTCAAAAACGCAAAACGTCTAATAGTG
GCAAAGGAAACAATCAACAACAAGAAAAGCCCAAATCCAC
ATTACAACCCCCTCCTCCACATTACAGCAACGGTCCCCCA
CATCCTCATAACATCCATCCAGGACAGCAGCAGCGTGGCA
TGCTGCACCCTGCTCAACAGTTTCAACGACCTTCAGGACC
AGGGATGTATGCTCAACATATGATGATTGACGCCCAGTAT
CCATATCCTGGGCAGAGACCCCTCATATCCAGGCCTCCTG
GGGACCATGAAAATCAACATGTACCACATTTTAACATGCA
GGGTTCCCACATAAATGGTCCACATCTTGGAACAAGATAC
ACAGTTGGACCTGATGGTCAACCTCTTCAACCTCCACATC
AACAACATTCCTATTCTGGTCCCACTCATGGTCCTTCTCT
TGGTCCAAGGCCAATGGCCCTTCAGCCTGGGGGTCTTTGT
TCCCCTCCACCTGAAGGCAATATGTACCCTTCACACCAAC
ATCCAGAAGGACAGTCTATGCGGCCAATGGGAAACGCGTA
TACCAGGCCAGGTGTTCCAATGCATAGTTCCTACCCTCCT
TATGGCCCCCATGGCATGAATATACCAAGGATGTGGCCAC
CCATGAACCATCAAAGGCAACCGACCCCTAGTGGAAATAT
GATGCAAGAACCGAGTGCTTCTGGCCAGCACCCATACAAT
CACAACATGATCCACTCTCAAAATAGTACAGGTTTTACTA
TGGCAAATGGTCAATTTAAAATGCCCTCTGCCAATTCCCA
AGGTCCTGTTGGCCAAAAACTACAAGGAGGCCCTCAGGCC
TCAAGGCTACATTTGGCATCTATGCTTGATAGTCCTGAGA
TGATAGCCCTTCAGCAGCTGTCAGCTTCATCATCTCATCA
TGTTGGGAATTTTCAGTCCCCCCAACAAAGTGGTGGTAAT
CCTTTAGCTTCTGCTGAACAGTCATCTCCTGAAAAACAGC
TCCACATGCCTTCTAGAGACAAACAGCACACCCCTGTGTC
CTCCAAAGGTTCAAGTCCAAAATCTGGCAATAAAATGTCA
ACTGGAGAAATCTCTCTGACTGAGGCTGAAAGTCGTTCTT
ATCCCAGTACAACAGAGAAATCTGAGCAACCTTCACAAGT
GACTGGTCTGGCATCTGTATCCTCTCCAAGCAAGGAACTG
AATCAGAATGAAGACAAACATAGACTGTCAAATCTAGAAA
AAATCCATGACCAACTGAATTCTCAACTAGGTCCTCCAAA
TCTAAAGTCTGTGGATGGCTTTTCATTTCCATTAAACAGC
CCTCAGCCAATGCCCCATAAAACCCAAGATGATATTCCCC
TCAACATTTCTCAACAAATAAATAAACATGCTTTACCACA
GATTATTCAGAATGGCTCTCAACGGCAGTCTCAGAATGTA
CCACCACAAATTCTACAGAATATTCCTCAACAGATGACAG
AGAATGTAATTCATCAATATCATCAGAGTGTCTCCCAGCA
AATACAAAACAATGAATCTGTTAGAGGCCCACAGGTAGGA
CCTCTCCATGGAATGCCACAGATTTCATCTCAGGGGGGTC
AGCCTGGTGTTCATCAGCCTGCAACACTCAGCTCTCTACC
TCCTAGCCACCCCGTATCTCATCCACTTGCTCAGCCGTCT
CCAGCTGATCAGGGAGACCAAAGGCCTTGTGAGCCTACCA
GCAGGAAAGTTTCAGATGGTAGTACAGCTTCCCAAGATGG
CAGCAATGCTAATTTGAGGACTGATTGTACCAGTGGGCAA
TACAAGCAACAGCCCTTCAGTCCCGAGTCAAAACCCCCCT
TGGTAAGGCAGGAGCAAGCACCCCTTCAAAATCAGACTCC
TCCAACCCACTCTCAGGGACCAGAGAGCAACAATGTAACC
CATTATGGTATAAGTGAGCCAGCACACCAACCGTTTGGCC
CACATCATGGTAGGCCACTACAAACGTCAAACCACCAGTC
TTACACAAGCCAGGGACTCCCGTCACACGAAAATAATCCT
AATCAAAATCCTGCACACTACCCTGCTTTTCACCAGCAAA
GCATTCAATACCAGTATCGCATGGCCACACAGCATTCTCA
GGGCCACCCAAGCATGCATCCTCAGTTCCAGCAGCAGCAG
CAGTTTTATCAACAACAACGACATGGAAGACCTGTATTTC
CAACTGAGGAGTGGCCTAGACATCCATACCAGCCTCAACA
CCCAGTGATGTCCAATTCTTATCCAACACCATCTGCTGGA
AGTTTTAATGGTAGGCACAATGACAATGGCATGTCTCCAC
ATGGCTCTGATGGATCTGTTGGGAGCTTAATGTCACCCAA
TCTTTTACCCGATGGATCCCATAGCAGTTCATTTGAAAAC
AAAGAGGATGGAAGCCCTGCTAAGCAGGCCAGGACAGAAG
AACCTTCTGAACGCTCAGAGAGCCCAAAGGAAATATTGGA
CCTGGATAGCCACAATGCTACAGCCCGACATCATACTTCA
GCCCAGCCGCACTCTAGTTTCCCATATGGGCCTCGTGGTA
TGCATCCCAGCATGCAGCAAAGTGCTGCTCCGCCACCCCA
TATGATGGCAAGTGGGCCGTATTCTAGCCAGCAATTTTCT
GGTGGACATTTTGCACCACAGAATCCTCATCCACATTTGA
TGGAAGCTTTGCAGAGGCCCCAGCATCTGCCTTTCTCCCC
TGGTCAATCTCGAATGACTATGTATAGGCATCCAAATGTT
GCAGGGCACTTCCAGGGAATGATGGTTCCTCAAAGAGCAG
TGGTTGCAGAACATTTATTTCGCAGTGGGCACCAGATGTT
GCGTACAGCCTCTCCAAATGGCCAGGGCCATAAACAAGGA
GTATGAAAACTAGGATTTTGGTGGCAGTCCAAGGGAAATG
AGTACCTTCTACAGCACAATTACATCCTGCAATATACAAG
GAAATAAAGACCCAACGAAATAGATGTTTAGTGTGTTTGT
TTGCGTAAAAGGGCAAGTTATGTCAATTGGAGTCAATTGC
TCCCCTACTCGTGCAAAAAACTATTGGAGACACCATCCTC
CCCTGGCATCAACTTTCACTGAGGAGGGAAAGAACAGTTT
GCAGTGCCAAGAAGTAGTGGCCACAGCAGCTTTTCTTCTC
ATCCTGGTTGGTTTCTTTGGCCACATCCCTAACAAAGGAA
CACAATCTCCAAGCTCTTTGCATGAGCTTTTACTTTGAAA
GTAAAGATGCTAAAATGTATACATGAGAAGAGCAAGATGT
TAGTTACCAGTTGGTATTCTGGTTCAAAATTAAACTCAGG
TGTAGCAAAGAAGGTACTGAGGCTACTTGAGCTTTTTCAA
AGCTCCATGGACAAACTAGACTCTTGCCTTCATATACTTT
TGAATGTTCTGTGAAATGATTTTAGTATAGTAATTCAACT
CAAAGAATAAAAGGAAGACCTTCTCCATGGGGAAAGTGAC
AACAAGTGTTTTAAAGAGGTGGTGTTCATCTTAAGTAAAA
CACATTATCCACTTTTTTTCTGGTGATGTGCATTCTTTTA
ATGCCACTTCAATTTGAAGATTGTATTTGTTCTTAGACTG
GCAGAGAACTCAGCTGCTCTATTTGTTATGCACTAGGAAT
AGTCTTTCATACTGGAATTAGTGGCCTTGGACTAAAATTA
GACGTGTGCTTCTTTGTATGGGACTAATTTCACTTAAGTT
GTTTCTATCTCTGATGTTTTGTCTTGTTTCATTTTGATGT
GTCCTGTGTTACGTGTGCACAGAATAAATCTGATTTCAGA
TAGGAAGTAACCATCTTTCACATTTTTAATATCTAGACAG
GCCACTAGTAATCTGCAGCTTTTGGGATTCCATGAAGACT
GGTTTACTCTTTGTGACCTGATTTATTCATTACTGCCTAG
CAATCTCAAAATGTTGTTTTTTTTTCTCCACATATTGGAA
CGTAAATTGAACATCTAGCTAGAGTCGCAATACTAACAAT
GTGTTAGATGTGAGTATGTATCAGCCTTAAAACTGACTTG
TAAAAGTACCACTGTAGCTGCTTTTATCCAATAGGAGAAA
TGTCGATGTGCTCATATTTTACATGAATGCTTCCTGTTTT
GACTCAGCGTACTGAATATGTCCTCAGGGTGTAGTGGTTT
TAATACGGGTATTGTCAATGACTTTTTAGTGACAAAATTA
CAGTGAAATTTCACTGGAACTGTGATTAACTTCAGTTCCT
GTTTGAACATCAGTACAGATGCAGGAACGAGGCGAGCAGT
ACTTGTGGTTTTTGGAGTTTGTCACACTTGAGTGAGTCTG
AAATTGTTTTAAATGCTTTTTTTGTAATGGGCAAGGATCT
GAAAACCAAGTAGGATGGTTTTATCCAACTTCATTTCTTC
TACTATTGTTGCCCTGCACTAAATTAATCGCTATCATATC
TGCTTTGTTTAATGTGTTCGATTAGTCTGTCTGAATTTCT
ATTTAGATTCAGCTCATACTGACAAACCATTGAAAAGAAA
CAAAAAATGTCAGAATATGGCAGCAAGAATATCTACCTCA
TAATGCCAGAATGTGGCATATTTTCCATTCCCTTCACAGA
CATGTGCAAAAATTATTTTTGTCACTTGTTTTTCTTTATA
CTCTGAGATATGCTTTTTCCACGATTGAAGGCTCTATCTT
TAAAACAACACTATAGCCTTAATATGTCCAACTGTACAAC
AGTCATTGCTACTTTATTGGTGCCAAGTTTGAACATGATT
AAAACATCTCCATTCTGTATTTTCAATTCTGGGGTTCATA
ACTGTAAGTGTAATGAAGGCAGCATCCCAGGTTAACATTT
TGGCCCTCACTTTGCAGCTTTGTATCATCCACATATTGAA
GTGGAAAAACGGTTGAATACCTTGTATGAAGAAACTTGAC
AGTGATTTCTGTGGTACAGTAAGATCTTTTGTCCCTGAAA
CCTGTGATAGTGCATAATGTCAGACATTGTAGTATTTTTG
TGGACATATAAACTGTTTATATGTATTTTATGAACTAGGG
ATATTAAAATGCTAGCAACTGTGAGATGACATGGGCATTA
TCCTCCATTTTGTACTCACATGTGAAGTTTTATCACTTTG
CCAGTCCTCTGACAGACTGTCCTATTCCACTGTTAATATG
TAAAAGGGATAATTTAGTTGTATTGTACTACAAGAATGTG
TGGGTTTTGCATTGTACAGTTTTTTATTTTTATTTTTTTT
TTTATGGGTATTGGGTCTGGATCTCTTGAAACCCTTCAAC
ATTTCTGCTGTTCTCTGTTCTGTCTGTACTGGTTAAAGAA
CTAGTTGGTTAAATGTGAATCATATTTATTTGCTCTTATG
TTTTTTTGTAAATTTTGTCTTTTTTTAAATATAAATGTGT
TCTCATGTTTGTTTTGAAAAAGATTCACTTTACCTCAGTA
GTAAAATGGCATCCAAAACGACACCTGTAACTTTCAATAT
ATGAAGTTTACAAGTTCTTATCTGACTGACAAATTATTTT
GGAAATGAACCGAAGTATTTTCTATACTGTACATTTCTTA
GAATAAACTACGTTTCATTAGTTTCTGCTTGTTTCAAGTT
TCTGTTCATTACCCCTTAAAAATAATCCACCTTGTGAAAA
TTAACCATATAAGCTATTCCATGCAAATGTCAACCTTGCC
ATAAAAAAAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cecr2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056483 (1),  Ensembl_Trans:ENSDART00000110426 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC154471 (1) 2271 bp
GenBank:CO357827 (1) 720 bp
GenBank:BM859356 (1) 630 bp
CITATIONS (2)