header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4155
Transcript Name: csnk2a2b-201
Previous Names: ch211-172l8.5-001, ck2a2b-001, csnk2a2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056455 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056455|OTTDARG00000039321|ZDB-GENE-090406-4 csnk2a2b|OTTDARP00000044270 CH211-172L8.5-001 LG_ CR381560.8 Danio rerio protein_coding NOVEL, 2547 bp
CACATATGGGCGCATAGCAACGGACAGACGTGCCCACTGG
CCATAGCAACTTGTACTTCCGGATTTTCGATGCTAATTGA
TAAAGCTACCATGAGCTTCCGGGTCAAACCGTAGCTGTCC
GTTTTTTCCTGCAGCAGCACGGGGGGGATTGGTCCGGAAA
ACCCGAACCCCGCTAACAAGCACAGCACTGCACGGGATTA
TAAACGTTTTTCGCGATTCCTGCATAACGGCTACGCACGC
GACGTCACTGTGACACGGTTTTTAGCGGAGATCAGTTAAA
CATCGATCTCGAGTCCACCGCCTCCCGTTCTCTCTCTCTC
CGTCTCTCTCTCTCTCTCTCTCTAACCAGTCAATATCCAG
CTTAGGCACTGGTTAGTTAAATTCTACTCACTCACCGTGG
ACTATATTTTGCAACGCCACTTACTCCAGACTGAGAGGAA
TCACATCCTGGCGCTTTTTGTTTTTCTTCTCGGTTCTCTA
TGCTTTGGATTTAGGGATTTGGGGCCCCTTTGGGGTGGTG
GGGGGGTTTAACCCACAATAATTAGATTTAAACAAACCCC
CCCGCCTACTATCTATTTTTAAACTTTTCACAAAACTTCA
ACACATTCAGATCGGAAATAGACGTCGCATTCGCACTGCC
GGAGCATTTCACAGACTATCCACCATTCATTTTCAACCCT
CTCGGAGCTCCAGGCGGTCAGAGCGCCGCTGACAAGCCGG
GGAACGAGCGCTGCTCAGCGGCCAACGCGCTTTATCTTTT
CCGCCGCTGCTATCAGATATCGCACGCCTCAATCGGATAC
AATCACATCTCCTGGCTGGTCTGCCTATAATCGCTGATCT
TTCGTTTGTGTGTGTGTGAGTTTGTGTGTTTGCGCGTTTA
TCTCTTATTTTATTTTATTTTTGCGTGTTTTGGTTTGGAT
TTGGAGATTTCTCGTACACCCTGAGCCCCGTCACGCGCCA
TGCCCGGCCCGGTGGCCGGTAGTAAGTCTCGGGTGTATGC
CGATGTCAACACTTTGAAGAGCAGGGAATACTGGGACTAT
GAGGCCCACGTGCCCACCTGGAGCAACCAGGAGGATTACC
AGCTGGTACGGAAGCTCGGGAGGGGCAAATACAGCGAGGT
CTTCGAGGCCATCAACATCAACAATAATGAAAAGGTCGTG
GTCAAAATCCTCAAGCCTGTCAAGAAAAAGAAGATCAAGA
GGGAGATCAAGATCCTGGAGAACCTGCGAGGGGGTACCAA
CATCATTCAGCTAATGGACACAGTTAAGGACCCTGTGTCT
CGAACGCCTGCGCTTGTCTTTGAATGCATCAATAACACAG
ATTTTAAGGAGCTGTATCAGAAATTAACGGATTATGATAT
ACGTTTTTACATGTATGAACTACTAAAGGCTCTGGACTAC
TGCCACAGTATGGGGATCATGCACCGCGATGTCAAACCCC
ACAATGTTATGATCGATCACCAGTTAAGAAAGCTGAGGTT
GATAGACTGGGGTCTTGCTGAGTTTTATCACCCTGCGCAA
GAGTACAATGTCAGAGTGGCTTCACGCTATTTCAAGGGTC
CAGAACTGTTGGTGGACTACCAGATGTATGACTACAGTCT
GGACATGTGGAGTCTGGGCTGCATGCTGGCTAGTATGATC
TTTCAGAAAGAGCCCTTCTTTCATGGCCAAGACAACTATG
ACCAGTTGGTGCGGATTGCAAAAGTTCTTGGAACAGATGA
GTTATTCGGATACCTGCGCAAATACCACATCGAACTGGAT
CCACGATTTAAAGACCTGCTTGGCCAGCAGACACGGAAGC
GCTGGGAACAATTTGTGCAGACGGAGAACCAGCATTTGGT
GAGTCCAGAGGCTCTGGATCTTCTGGACAAGCTGCTACGC
TACGACCATCAGCAGAGACTGACCGCCACCGAGGCCATGG
AGCACCCTTATTTCTATCCAGTGGTGAAGGAGCAGTCTCA
CACTAATGCAGACGGCACTATAGTGTCAAGCGGAACCAAC
ACACCCCGATGAGAGCAGGAACTGAAAATGGAAGGCGTTT
GTTACCTCAGATTTTTTAACCCTCGTGTCTGAAACCTCTT
CAAGTGTACAGTGAAACGTTGGATCTTCAGCAGCACCTGT
TACACCTCGTCTCTCAGACACACACACACACATGCGCCCA
CACTCGCATACACACACTCACTCACATTTCAACTTTCCGT
GTCCGTCAAGGTCGGTCTGCCCTTCTATAACAGGTCTGTT
CCTCTAGCTTGAAGATTTTCCAAGCTTTCCCTCCCCAAAT
TTTAGATGAAAGGAAAATATCATAGACTCCGCCCCAAGTA
CTCTGGCCCCGCCCACGTTAAGCTAGGCATGGAGAATGAA
GAGCAGAATGAGCCCCGCCCCCCTCCCTCTCTCCTTATTG
GTCTGTGTGTCCGTCTGTTCAGTATTCAGACCTTGGCGCA
GCCTACACATACTGTAGTAATAAAGTGGCATGGTGGACCT
TTATTTCTTTGCTCTAGGTAGATTGATTACTATATTAATG
AAAATAAATGATTTTTATTTAGATTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csnk2a2b-201 Contained in:

OTHER csnk2a2b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056455 (1)
  • Ensembl_Trans:ENSDART00000045488 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EG583514 (1) 900bp
    GenBank:EE687605 (1) 893bp
    GenBank:CN328368 (1) 892bp
    GenBank:EG576299 (1) 887bp
    GenBank:EG578039 (1) 870bp
    GenBank:GO943388 (1) 675bp
    GenBank:EX154594 (1) 651bp
    CITATIONS (2)