ZFIN ID: ZDB-TSCRIPT-131113-4149
Transcript Name: mhc1lia-201
Previous Names: dkey-52p2.7-001, mhc1lia-001, si:dkey-52p2.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056419 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056419|OTTDARG00000039300|ZDB-GENE-140820-10 mhc1lia|OTTDARP00000044237 DKEY-52P2.7-001 LG_ CR854891.10 Danio rerio protein_coding PUTATIVE, 1078 bp
GAGTTTGAAGTAAGTCTGTGAAGTGAGTGCTAACACAAAG
TATTGCACTGCATGTGCTAGAAAAATGGGCCAAATCCTTT
TGTTTTTTGTGTTTTTACTTCCAACTGCAGCTCCAAAAGG
CTCTCACTCTTTATGGATGCTTGTAATGTACATTAAAGGA
CAAACGGCGTTTCCTGAATTTAGCTATGTGATGATGCTGG
ATGATGTCAGTGTTCTCCACTATAACGGTGATACAAATAG
TCTCATAGCAAGAGGAAACACAAAAGCTGACGATGACGTG
TTTAATTTAAATGCGCTCCCCATCATACATGATCATCTAC
AATCATCTTTTGAGGACAGGTGGACATTAGCAACAACACA
CTTAAATAAAACTGACGTTGGTCGCGTGCGAGCTACAGGA
TGATGGCGAACCAGGACGAATGATTTTACGAAATGCTTTT
GGAGGATCCACGACAGATCAGCTGCTATTTGTTGACAAGA
AGTTTACATACCACGATAGCTTCAACGTCTCGACCCATGT
GCTTCATGCTCATCATGATTACAACAAGTACCTTTGTGAA
AAGCTATTACAGCCGTTCTGCTTTCAAACACTTAAGGGTT
ACCTGGTAAAAAGTAGAAATCAAATCAATAGAAAAGTCAA
ACCCAAAGTCAGACTCATTCAAAAAGCAAACTCAGATTCT
GGAGGTTTTCGTGTGAGTTGTTTGGCGACAGGATTTTACC
CTCGTCACATCAACCTGACCCTGTTGATAGATGGACAGCC
TGTATCTGATCATGAGGTCACTGGAGGAGATCTGTTGCCC
AATGGAGACGGGACGTATCAGATGAGGAAGAGTCTGGAGA
TCAGAGCAGAGGAGAGAGAAAAACACAAATACTCCTGCTC
TGCCAAGCACCTCAAAATCGACAACAAACTGGACATTTAT
TTAGATTTTGACCCTGAAGAACCATTTCCTTTAGTGCTGA
TACTTTTATCGCTGGTGTCAGTGTTTATAACTGGAGTCAT
CATATATAAATGCAGGAAGAGGCGAGCTGTAATTATTTAT
TTGCTAAGCAAATGTATTAAAAAAATTACTTCATAAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mhc1lia-201 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056419 (1),  Ensembl_Trans:ENSDART00000156589 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH452880 (1) 1028 nt
GenBank:EH442006 (1) 680 nt
GenBank:EH467894 (1) 660 nt
CITATIONS (2)