ZFIN ID: ZDB-TSCRIPT-131113-4148
Transcript Name: mhc1lla-201
Previous Names: dkey-52p2.4-001, mhc1lla-001, si:dkey-52p2.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056416 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056416|OTTDARG00000039297|ZDB-GENE-140820-13 mhc1lla|OTTDARP00000044234 DKEY-52P2.4-001 LG_ CR854891.10 Danio rerio protein_coding PUTATIVE, 813 bp
CTTTTACTGCAACTTTATACACCACAAGCAATCAATTCAA
CTTCAGCAGAATAGCTTGTGCATCTGAGAACATGACTGGC
AAAGTATTGTTTGTCCTGTTTCTGCTGTCAGCTCCAACCA
CTGTTTTAACAGATTCTCACTCACTGTGGTTGCTTGGAAC
TTACATTAAAGGAGAAACTCAATTTCCTAAACTAAGTTTC
ACAGTCATGCTAGACGACTTGAGAGTAGGATTCTATAATT
CTGAAACAAAGGAGTTCATTCCACGGGATAATACGACAAA
TGAAGATGAGGCTGTTTCTGATGTGCTTACTGTAATACAA
AATACGTTGGAGCCCTTTATGATGTCAACACTAACGTTTA
AGAACGGTACAGAAAGTCCTCAACTTTTTCAAATTACATG
GCATTGTGAGCTGTTGGACAATGATAAGCCTGGACAAATT
ATTTTTAAGATTGCTTTTAGTGGCTCAACTACAGATGAAG
TGAGTTTTTATAATGACAACTTTACATGTCAATGCCAAAA
CAACATGGCAACTGTACCGTTGGAGTCTTTCCAGATGCAT
TATGAGACCGTATGTTATCCAAACTGCATAGCAACCATCA
GAGATTATTTAAAAAAAAGACAAACTCAAGTAAATGGAAA
AGTACAACCGAAAGTTAGACTAATTAAGAAAGTACACCCA
AAATCTGGAGGGTTTCGCTTGAGTTGTTTGGCGACAGAAT
TTTACCCCCATTCCATCAACCTGACCCTGTTAAGGGATGG
ACAGCCTGTATCTGATCATGAGGTCACTGGAGGAAATCTG
CTGCCCAATGGAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mhc1lla-201 Contained in:
[BAC] DKEY-52P2 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000056416 (1),  Ensembl_Trans:ENSDART00000157325 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF997769 (1) 760 nt
CITATIONS (2)