Transcript

si:ch211-280a23.2-201

ID
ZDB-TSCRIPT-131113-4142
Name
si:ch211-280a23.2-201
Previous Names
  • ch211-280a23.2-001
  • si:ch211-280a23.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056395 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056395|OTTDARG00000039281|ZDB-GENE-131119-11 si:ch211-280a23.2|OTTDARP00000047608 CH211-280A23.2-001 LG_ CU571064.7 Danio rerio protein_coding PUTATIVE, 1882 bp
GAATTCCTCAGAGTGACAAACGATCGAGTACAGTGAACAG
TGATTTAATGACTTTAGCGATTTGTTTTGCATCTCAAACA
GAAAATAATATGTCAACTGTGTTTTTTACTCGAGAAAATT
TGATCACGCCTGTATTTGTCCACAACTATCATCAGAGTGA
CTCGATGGCTTCTCCTACAACTCCTACCATGTCGAGAAGC
CCAACAGAAAACCCAGAGAAACGGAGGAAAGGGAAAAGAG
TCTCTGCTTTCTTTAAGAGAGCATGGAAGGCTGCAAAGCG
CCCTTTCCTTAGCTGTGACCGGAGCAGAGTGGTTCCCTTT
GAACCACAGTCGGATGTCAATGATTTCGAGCATCTGCCTG
TTCCAGGTCCCTCCAGGACCGTCACAGCACATGCAGACCT
TGAGCCGGTGTTGCTGCCAGGCCAGGTCTGTGAAGAACCT
CAGCCGTTGAGTGTTCCGGGCCCCTCCAGGATCAAGCAAA
CAGCAGATTCGGCCCAACCTGAGTCCTCAACGGCCCTCAA
CGGTCATGTTGACACTGAGCTGGTGTGTCTGCCAGGCCAG
GTCTGTGAAGATCCTCAGCCAATCAGTGTCCATGGCCCCT
CCAGTACTAAGAAAATGACGGATGCAGATTCGGCCTGTCC
TGAGTCGCCTCCGTCTGTTCAAGACCCCTCTAAAATTGAT
GGGACTGATGAAAAACCCAAGAAAGGAAGGAAATGGAAAA
GAGTCTCTGCTTTCTTCAAGAGAGTATGGAAGGCTGCGAA
GCGTCCTTTCCTGTGCTGTGACACAGATGTAGTCCAGCGT
TTTACGCCACAGCCTGAGCCCGAGCTCGAGTCAGACCCAG
ACCTTGACTCAGAATGTCTGCCAGGCCAGGGATTTGATCT
GTCTCAGTTTGAAGTCGGAGACCTGATTGGAAAAGGAGCC
TTTGGCGAGGTGTATGTGGCATCTCACAAACGCAAGAAAA
GAGTAAAGGTTGCCCTGAAGTGTATGATGAAGAGTCAAGA
GGACCGTTATCTGGACGTTGATGGTCATTCCACACCTGTG
CTTGCGGAAGTGGCAATGATGCTTAGGTTGAGGAATGCAC
CGCGATGTCCAAACATCATCAGATTACACGACTGGGTTGA
GCTTGAGGACAACTTTGTTCTCATTCTGGAGTACGCAGAG
TCATGCCAGACCTTGCTTCAGTACATCAAAGATACAGGGG
ACATTGAAGAAAACCAAGCACGCCGGTTAATGCGTCAGTT
GATCCGAGCCGTAATGTTCTGCACCGAGCGTGGAGTTTTC
CACGGTGATATACACACGGCGAACATCCTGGTGACTCTAC
CCCGATTAGAGCTCAAATTGATCGACTTCGGTTGTGCTCA
GCCAATTACCCACAAGCCTTTCAACAAAAGTGACTATCGA
GGAGCTGGACACGGCATGCCACCTGAGGCTTTGAGGGGTC
GTGTATTCCATGCTAACCCGGCATATGTCTGGACAATAGG
CATCATGCTGTATGAAATAATGCATGGACGACTGGCCTTT
TGTAACAGACAGTCATTAATGTTTGGCTCCATTCAGATAA
ACCCCAGATTATCTACAGCATGCGTGGACCTGATTTCCCA
GTGTTTGATCCGTAATCCAGTTCAACGGCTACAGTTACAT
CAGGTTGAAGAGCACTGCTGGTTCAATCCAACGACCCCAA
ATCCTGTGAAGCAGTTCTTCAAGAGAAGAAAACACTAAAG
AAGCGAGGAGGAGGAGGAGAGCACCATTTCCAGACATTTC
ACAAGACTGTTAAAGTTATTAATTACTCCCTCATGTCATT
CCAAACCCCTAAGACCTCACTTTTCCTCAGTGTCAGTTCA
TGACGTGTGTTGATGAGAGCTCTGTCCTGCGCTGTATGTG
TG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations