ZFIN ID: ZDB-TSCRIPT-131113-4097
Transcript Name: calml4b-204
Previous Names: calml4b-002, ch211-139f22.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056245 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056245|OTTDARG00000039182|ZDB-GENE-071009-6 calml4b|OTTDARP00000044109 CH211-139F22.1-002 LG_ CU183952.17 Danio rerio protein_coding PUTATIVE, 562 bp
TTTTCATGTAAAACAATATACTAACTAATTAAATTGGCTT
CTTATGTTCTTACAGGCGAAATTCCTCAGTCAAGATCAAA
TCAACGAGTATAAAGAGTGTTTTTCGCTGTATGACCAGAA
GCGCAAGGGTAAACTGAAGGTGCAAGATCTGCTGACGGTC
ATGAGCTCTCTTGGTTGCTGTCCGACCCTGCCGGAGCTCC
ACAGACACTTGCTCTCCCATAAAATCGATAAGCACGGAGA
GTTGGATTTCTCCACGTTTCTCAGCATCATGCATGAGCAG
ATCCAGCAGGAGAACCCGCGGGCCGAGATCCTGCAGGCCG
TGAGGCTGACGGACACTGAGAAACGAGGATTTATCACTGC
GGCAGAGCTCAGAGCCAGACTGACTCACTTTGGAGAAAAA
CTAAGAGATCAAGAAGTTGACGAGCTGCTGAGTGAAGCTG
GTGTGGCAAATGACGGACAAATTAAATACGAGGACTGCGA
AAGGATAGTGACTCTACTGACCAGGCGCAGAGATGAACCT
TTAATTCCCCGGCAAGACAGCAGCGCGGTCTGAGTGGGTG
AG

calml4b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA calml4b-202 (1) 1254
calml4b-203 (1) 548
calml4b-204 562
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
calml4b-204 Contained in:
OTHER calml4b-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000056245 (1)
  • Ensembl_Trans:ENSDART00000157163 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV562982 (1) 546bp
    GenBank:AL924036 (1) 535bp
    CITATIONS (2)