ZFIN ID: ZDB-TSCRIPT-131113-4074
Transcript Name: slc17a7b-202
Previous Names: slc17a7b-001, ch1073-327k18.1-001, si:ch1073-327k18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056122 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056122|OTTDARG00000039123|ZDB-GENE-131125-32 slc17a7b|OTTDARP00000044012 CH1073-327K18.1-001 LG_ FP102937.4 Danio rerio protein_coding PUTATIVE, 1603 bp
ATAAAGTGCATGTTTTGTGTTTGTGTGTTTCAGAAAGCAC
AGTTCTCCTGGGATCCAGAGACTGTAGGAATGATTCATGG
CTCGTTTTTTTGGGGATATATCGTCACTCAGATTCCAGGA
GGGTTTATCTGTCAGAAATTTGCTGCCAACAGGGTTTTTG
GCTTTGCGGTGGTGTCCACGTCTATCCTGAATATGATGAT
TCCCACTGCGGCACGAATGCACTTCGGCTGTGTGATCCTA
GTGAGGATATTACAGGGGCTCGTTGAGGGTGTTTCTTACC
CAGCATGTCATGGGATCTGGGCGAAATGGGCTCCGCCTCT
AGAGAGAAGCCGATTGGCCACAACAGCATTCTGTGGTTCG
TATGCGGGCGCAGTGATAGCGATGCCGTTGGCTGGTGTTC
TGGTCCAATACTCCGGCTGGTCCTCGGTCTTCTATGTGTA
CGGTAGTTTTGGTGTGTGTTGGTATCTGTTCTGGATTCTG
GTGTCGTATGAGAGTCCAGCAGCTCATCCCACCATCACAC
CAGAGGAACGCAAATACATCGAGGACGCCATCGGGGAATC
AGCTGGACTGGTCAACCCACTCACGAAATTTAACACCCCC
TGGCGTCAGTTCTTCACATCGATGCCCGTCTACGCCATCA
TCGTGGCCAACTTCTGCAGGAGCTGGACCTTCTACCTGCT
GCTCATCAGCCAGCCGGCGTACTTTGAGGAGGTCTTCAAG
TTCGAGATCAGCAAGGTTGGCATTCTCTCTGCTCTCCCTC
ATCTGGTGATGACCATTGTTGTGCCCATCGGCGGTCAGTT
GGCAGATTATCTGCGAACTCATAACCTCATGACCACCACC
AACGTCAGGAAACTCATGAACTGCGGAGGTTTTGGTTTGG
AGGCCACGTTTCTGCTGGTTGTGGGTTTTTCTCACACGAA
AGGAGTCGCCATTTCATTTCTGGTTCTTGCTGTTGGGTTT
AGTGGTTTCGCCATCTCAGGCTTCAATGTGAATCATCTGG
ACATTGCACCGCGCTACGCCAGTATACTGATGGGCATCTC
TAACGGCGTCGGGACGCTCTCCGGCATGGTGTGTCCTTTG
ATTGTTGGTGCCATGACCAAAAACAAGACGCGCGAGGAAT
GGCAGTATGTGTTTCTCATTGCTTCACTTGTTCATTATGG
TGGAGTTATCTTCTACGGTCTCTTTGCGTCAGGAGAGAAG
CAGCCGTGGGCCGAGCCGGAGAACACGAGCGAGGAGAAAT
GCGGGATTTTAGGAGAAGACGAGCTGGCGGATGAAACTGA
GGAGCTGTACCGCTCAGCGGGCGGTGGCTATGGTGCAACC
ATGCAATCAGGAGACCCCAACGGGGCGGGGACTGGAGGGG
GCGGAGCCGGAGGTAGCTGGGTCTCAGACTGGGACAAAAC
GGAGGAATACGTTCAACCAGTGGGAACAAACAGCTTCCTG
TACGGAGGAGAAGAGGGCAGAGGGATGAACGAATGACTTC
CACAGCTCACAGAGTACAAGCAGAACGGGACGGGTGGGTG
AAACACATCCCAAACACTAACTGACTGGAACGAGGACTTG
CTTTTTAACCCAAACTAAAAGAAAATACTATAAGTAACAT
CAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc17a7b-202 Contained in:
[Fosmid] CH1073-327K18 (1)

Genome Resources: Vega_Trans:OTTDART00000056122 (1),  Ensembl_Trans:ENSDART00000154539 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR926637 (1) 539 nt
GenBank:EB960478 (1) 243 nt
CITATIONS (2)