header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-405
Transcript Name: usp43b-201
Previous Names: dkey-164p3.3-001, usp43b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053371 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053371|OTTDARG00000037406|ZDB-GENE-120524-2 usp43b|OTTDARP00000041993 DKEY-164P3.3-001 LG_none BX465842.5,BX571780.9,BX120006.15 Danio rerio protein_coding NOVEL, 4404 bp
CCTGGGTGTGATTATTCGCAGCCACAACTGTCAATCATTG
CATCGCTCGCAGATTCCCGCCAGTATGAAGTTGGAGGAGC
TCATGCTACCACTGACCGCCGGTAAAAACGCGCTGTCAAT
CATTCATTCTGTCCAAACCGCCTGACGTCACAGGAGACGC
CGTACTCACCGCCGCGCTACCTGTCAATCATTCCTTCACG
GCGGGCGCGAGGAAGACTCTGCGCTGCCGTCCACAATGCT
GAGTGTCGAGGCAGGATCAGGTGAGGAGAGCAACGCTCTG
TGTGCTTGAACGCCGTTATCCGGTGGAAAATAAACAAGAA
ATATGGATAAACGCGACAAAAAGGCGAATAAAGACTCAGG
AAGCAAGTCGACTAAACGCACAGGGAAGCTGTTCCGGAGG
AAATCGTTTAAATCCGTGGAAAGTTTGGTGAGTAGGATCT
TGAAAAGTTTGGGAAGCTTAGCAAGCGGCGGAGAAACAGC
CGAACGGTCGGATGCTGAGGATGATGACGGAGGGTTTGGA
GAAAGCGCACCTTGCGCGGGAAACTCGGTGAAAAAGGAGG
ACAGCAGCACCAGCAGCAGTCAGGTGAGGAAAAGTTCGTC
TCTTACCAGCCGTTCCTCCGCGAAAGAGCGAATGTTTTCG
CTGTACGGTGATAAAACCCCGGGTGTGCTGGGTCTGAAGA
ACCACGGGAACACCTGCTTCATGAATGCCGTCGTGCAGTG
CTTAAGCAACACAGACCTGCTCGCTGAATATCTTGGTTTG
GAGCGATATAAACGGGATGTTTGTCACAACGGAATAAACG
GATTTATAAGGAACGGGAACGGGCAGAACGAGAAAGGAGA
GGTGACGGAGCGGCTCGCGGTTTTGGTCCGAGCACTTTGG
ACATTTCAGTACACTCCTCAACTCTCTGCTGAGTTTAAGA
TGACGGTATCTAAATATGGTGCTCAGTTTCGAGGGAATTC
CCAGCATGACGCTCTGGAATTCCTGCTCTGGCTTTTGGAC
CGCCTCCATGAAGACTCAACTTCAGTCGTCCCCAATGGGA
ATAACATAAACAAATCAAAGAACAAGGGTCAAGAAGGAGG
TGATGAAAAGCCTGGCTCTGATACCCTGAGCCCTCCTCAG
ACGCAGCCTGGTGTACGTCACAGCTTTGTACAAGAACACT
TCCAGGCACAATACAAGTCATCTCTGACATGCCCTCATTG
TCTTAAGCAGAGCAACACGTTTGATCCTTTTCTGTGCATT
TCTCTCCCCATTCCTCTAAGACAGACACGACCTGTGTGTG
TGACTTTGGTGTTCAGCAGTAAAGGGCAGCGCTATCTGAG
AGTCGGGCTTGCTGTGCCTCTGTTCGGCTCTTTGGCTTGC
CTGCGCAGGATGGTAGCAGATGAGGGCAAGATCGCTCCTG
ATCAGGTGATTTTGACAGAGATCTACACAACAGGCTTCCA
GCGCTCGTTTTTTGATGACGATGACTTAACCATCATAGCA
GAGAGTGACATCATCTATGCCTTTCAAGCTTCACCCCTTT
ACATCAGGGGTGGCTCTGCACGAATCTCAGGGTTTCACCA
CAGTCTTCCGTCCTCTCCGTACTCCTCGTCTGGTCCGGAG
GGTCACCGTCTGGCCGCGTCCGGTGCTTTGTCATCTGAGT
TCCTGAACCAAACCGATGGGATGCTGAAGGTCCTGTTGCT
GGTGTGTAATGCCGCTGGAGCAGGACAGCAGGCAGTGAGA
TTCGGTCCTCCATTTCTCATGCGAGAGGACAGATCAGTAT
CATGGGATCAGCTCCAGCAAAGCATCCTCAGCAAACTCTA
CTATCTCATGATCAACGGCTCACAGGCTCATAATTTCAGG
GTGTTGTTCAAGATTCGTGTTGTTGGAGGATCTGCATCTT
ATAGCTACTTAAATCCTCAAGACGGACGGCCGCTTTTCCA
CCCAGCAGTGGACAGAGCTCTGAAACTGTGCGGATCAGGT
GGACCACCACATGTGAAGCTCATTGTTGAATGGGAGCACA
GAATCAAAGACTGCCTGTTTGGTAATATCCAGGAGGAGGT
GGTGAAGGACTCGGAAAGTGTTCGTGCTCAACAACAACAC
CACGTTCAGCAACACAGCTGCACCCTGGACGAGTGCTTTG
AGCTCTACACCAAAGAGGAACAACTGGCCCCCGATGATGC
GTGGAAGTGTCCTCACTGTAAGCAGCTTCAGCAGGGCACG
GTGCAGATGAGCTTATGGACGCTACCAGACATCCTAATCC
TCCACCTCAAACGCTTCCGGCAGGTGGGAGAGCGCAGAAA
CAAGCTCTCCACTCTCGTCCACTTCCCCCTAACAGGCCTC
GATATGGGCCGCCACATGGTCCAGAGAACCAGCTGTGCCC
GAGCGCCACCTGGCTGGAATAAGCAGGCCCATCGCAGGCC
TGAAGCTAGCAGATATGCAACGGACGTCCTGTACGACCTG
TACGCTGTGTGTAACCATCACGGAGGCATGCATGGAGGAC
ACTACACAGCATACTGCAGGAACTCGGTGGACGGTCAGTG
GTACACCTATGATGACAGCAGTGTTGAACCCTTGCAGGAG
GGAGAAGTGTGCACTCGCGCTGCTTATATCCTCTTCTATC
AGAGACGTGATGCCATCCCTTCTTGGTCAGCTAGCTGCTC
GCGACAAGGTTCCTCCAGCTCATCTCTGTCAGATCACTGG
CTCATCCGATTAAATGCAGATGAAGGAATTTCCAATTCAA
CCAGCAAGGTGTCAAATTCATCTTCGGCTCCTGAGCCTCA
AACCCCTCACAGTCCTGTCATCCACAAGTCTGCAAATGAA
GACAACAGAGATGTAGCTGAAGCAACACCATTTGTACGAA
GCGTCCGGGGCCAGAGTATGAGCATGCGCTACCAGTCCAA
ATCCAAGACGGGTTCAGGAAAAGTTCTTCCACTGCGTTGG
TCGTTTGCTTCCAAGGAGCGCAGAAAACCCCCCAGCATCA
CTTCACAAAATGATAACGATGAGCTAGTGGAGTACCTTGA
ATCTGGCCGACGGCCCCGATGTACCAAGGAGCCTATAGTA
AGCATCGTTGCCAGTCCTTCACAGGTCAAAGGCCACCTTC
GTGAAGATGATTCCCTGAGTTCCCCCAGCTGTTGCAGCAG
TCTCAATGGTGTGGAGAGAAGTAGCTCTCAAGGCCCGGAT
TCTCCAAAAGTGCCTGAAGGCCAGAGTAGACCAACTTCAG
ATCTTAATGCTGTCAGTTCTGTCGACTCGAGAGCAAAAAA
ATGCTCAAAAACAACCCGGCAGGAGCACGAAAGGACTCAG
GCTAGTAAGTCACTTCAAGGTTCTCCTACTGCACTTTCCA
CTGGTAACAGTACATCTCATTCCAGAGACTCCACACTGAA
ACGGCTTCGAAACCCGGCAGCTGCAACTAGCAGAATTCAT
CCCAGTCAGATTCTGATGGCCACAGGAGAAAGCAGAGGTA
AAGATGGCATCCATCCCGTTAGCAGCACCTCTCAGCTCCA
GGATGGGTGCTCTAAGGAGGTGGGTCATGGAAAAACACTG
TCTAGTAAGAGCTTGACCAAACTCTCGTTGTCCAATGGCA
CTTTGAATGGGAAGGTCGTTGAGGTGAGGAAAACTGGTAC
TGTTCACAAGAGCACAAGTAAAACAAATGGCAGAGACACC
CAGGTTTTTTCAAACACTATTGATATGAAACGTGCCCACA
GCTCTTCAAATATTCAAAACAGGCTAGATATGACTTTAAA
AAGGACGTTATCTCTCCAAAGAAATGGTCCCCTGGTGCCA
GCTTCCAACAAAGGACTTGCAGTTGATAAATCCTCCTATG
CAACACTACAGAGAATCAAATACAGCAGCACTTCACTTGG
CAGGCAGAGACCTGTGCCCGAGTCTTGCTTCTGACGGGTT
ACACCTTCAAAATGGTGTTTGTACATAGTATGTTTTATGC
AGTTGAAAATTGCAAATCATTGCTCTATTCCAAAACCTCT
GAGCCTTGAGTGTATTCTGTCTACAGAAAGTCACCTTGTT
TTTGCCAGATTCAAGGTAATGTTATTTTGCAGAGAATAGA
TAAGGTTTTTTGTTTTTGTTTTCTCAATTCACAAAGTCCC
AAAGTTTAGGTTCGATTAAATGTTTTTGAAACTCTCTATT
GCTCACCAAGGCTGATTTTTTTTTTTTGTGCCAAAAATAC
AGCAAAAACATTTTCTAAAAAAATAACAACAGTCTTGTTT
TAATGGATTTGGAATGTAATTTATTCTTCTAATGGAAAAG
CTTCAGTCTCCAACGGAAAATTTCAATATGTTAATTTGTG
CTCAACAACTTGAATTTGAACCCACCCCTCAACCCCAAAT
AAGCTACTCTTATTGTAAGCTTAGATTTGGAGATGAGGCA
CAAAAATATTAGCACTTTAGTTTAGGTCACAATTTACAGT
ATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usp43b-201 Contained in:

OTHER usp43b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053371 (1)
  • Ensembl_Trans:ENSDART00000122735 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN328204 (1) 750bp
    GenBank:BM264931 (1) 627bp
    CITATIONS (2)