header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4049
Transcript Name: piezo2a.2-201
Previous Names: piezo2a.2-001, ch1073-433p8.1-001, si:ch1073-433p8.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055958 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055958|OTTDARG00000039026|ZDB-GENE-131119-76 piezo2a.2|OTTDARP00000043883 CH1073-433P8.1-001 LG_ FP245525.4 Danio rerio protein_coding PUTATIVE, 3277 bp
GGATGTTTTACGATGCCGATCTGGAGCAGTCGGAGCGTTT
CTACCGCTCTCAGCCTCAGCTCCTGCAGCTCTGCTACTCG
CTCTACAATGTGCTGGTGTCTCACTCTCAGATGGTCTGCT
ATCTGGTCATCATCCTCAACCACATGATCTCCGCCTCGGT
GGCCACGCTGGTGCTGCCCGTGCTCATCTTCCTGTGGGCC
ATGCTGTCGGTGCCGCGGCCCAGCAAACGCTTCTGGATGA
CCGCCATCGTGTACACCGAGGTGACGATAGTGATAAAGTA
CTTCTTCCAGTTCGGCTTCTTCCCGTTTAACCAGAGCATC
GAGGTGGACAAATCCAAGCCGTTTCACCCGCCCAACATCA
TCGGTGTGGAGAAGAAGGAGGGATACGTTCACTATGACCT
GGTGCAGCTGCTGGCGCTCTTCTTCCACCGCTCCATCCTC
AAGTGTTACGGGCTGTGGGATGAAGAAGAGCCGCGCTCCG
TCTCTCCACACACACACTCTGGCGCTGAAGAGAAAGCGGA
GTGTTTCTCCGAGAAAAGCCCTGTGGAGGACACATACACG
CACGCGCTGTCACACACACACCTCCGCTTGGCCAGAAAAC
AGCAGTCAAGTGCAGGCGTGCGCCGACAGAGCTCCAGCAT
CTCGCAGAGATCCGCTCGATCCAAAACAGGCAGTTCAGTG
TCCAGATCGAGTGTCCGCCGCTCTCTCAGCGCTCAACAGA
AGAGCCGTAAAGAACTGCTCATGGAAAAACTCAGAGAGCA
GCTCATCAGAGCCAAACGCTTCACTGTCAAAACTGTTCTG
GACGTCTACATCCCCATCAGGCAGTTCTTCTACAGCCTCA
TCCACCCCGAGTACAGCGCAGTGACGGATGTTTATGTGCT
GATGTTTCTGGCCGATACGGTCGACTTCATCATCATCGTC
TTCGGGTTTTGGGCCTTCGGGAAGCACTCTGCTGCTGCTG
ACATCACTTCCTCTCTGTCGGAGGACCAGGTTCCCGAGGC
GTTCCTGGTGATGGTTCTGATCCAGTTCGGGACGATGGTG
GTGGACCGAGCGCTGTACCTGAGGAAGACTGTGATGGGGA
AGGTCATCTTCCAGGTCATCCTGGTGTTCGGCATTCACTT
CTGGATGTTCTTCATTCTGCCCGGAGTCACCGAGAGGCGT
TTCAGTCAGAACACAGTGGCTCAGCTCTGGTATTTTGTGA
AGTGCATCTACTTTGGTCTGTCGGCGTATCAGATCCGCTG
CGGATACCCGACCCGCGTCCTGGGAAACTTCCTGACCAAG
AGCTACAACTACCTCAATCTCTTCCTCTTCCAGGGGTTCC
GGTTGGTGCCGTTCCTGACGGAGCTGCGGGCCGTGATGGA
CTGGGTCTGGACGGACACGACGCTCAGTTTATCCAGCTGG
ATCTGCGTGGAGGACATTTACGCTCACATCTTTGTGCTCA
AGTGCTGGAGAGAGTCCGAGAAGCGCTATCCTCAGCCCCG
CGGACAGAAGAAGAAGAAGGTGGTGAAGTACGGGATGGGC
GGGATGATCGTGATGCTGCTCATCTGTATCGTCTGGTTTC
CTCTGCTCTTCATGTCTCTGGTCAAATCGGTGGCCGGAGT
GGTCAACAAACCGCTGGACGTGTCCGTCACCATCACACTG
GGAGGATTTCAGCCCATCTTCACGATGAGCGCTCAGCAGA
ATCAGCTGAAGGAACTGACCGAATCAGACTTCAAGAACTT
CATCAACTCCTACAACTACGTCCCCAGTGCAATGCAGTTT
CTGGAGGCGTACCGGGCCGAGGACGTGACGGTGGCGGAGC
TGGAGGGAAGCTCCAACTCTCTGTGGACCATCAGTCCTCC
CAGCCGCAAAAACCTGATGGACGTGCTGAGCAAAGAGGAC
CAGTTCCCCGTCACCATGACCTGGAGCATACAGAGGAATC
TGAGTCTTGGAGCGAAGTCTGAATTCGCCATGGACAAGCA
TGTGACGTATCTGGACATCAAGACCAGGCAGGAGCTGATC
GCGCTACTCAACGGAACCAGAAACACACCGGTGCTGATAG
AGCAAGTGTTTCCCTGCTTCATCCGAGCACCGAGCGACTC
CAACGCCAAACCCATCGAGCAGCTTTACGAAGACGGAGTC
TATAAGAGCATCCAGCTGGATCTGGAGCGTTCCGCTAACA
GCAGTGAGGATCTGCAGGAGTGGTGGATCGTGGATGAGCT
CAGATCAGCGCAGAAGCAGCAGAGAGAAGCCGGACTGCAG
CTCTACGTCTTCAGTGATAAAGTCAGCCCTCCGAGCCTGG
GCTTCCTGGCGGGATACGGCATCATGGGTCTGTACGCGTC
GGTGGTTCTGGTGATCGGGAAGTTTGTGCGCGAGTTCTTC
AGCGGGATCTCTCACTCCATCATGTTCGAGGAGCTGCCGT
GCGTGGACCGAATCCTCAAACTGTGCACGGACATCTTCCT
GGTGCGGGAGACGGGCGAGCTGGAGCTGGAGGAGGACCTG
TACGCCAAACTGATCTTCCTGTACCGCTCGCCCGAGACCA
TGATCAAGTGGACGCGAGAGAAAAACAAATGAGCTGTGCA
ATAGATCCCGGAGGAGGAGCGGACGCAGTACTTGAAGAAC
AGAGAGAGACTGAGTGTGAGTTTGAGCGAGATTCAGCTTG
AGGATGAGCCCATACTGACACTGATGCGTGTGTGTGTGTG
TGATGGAGGACGAAGCACAACCGCTGCTGTTTACTGATGT
GTGTGTGTGTGTGTGTGTGTGCGCGTGCATAAAAGACAGA
CCAAACTGAGAAATGCACTAGAAATGTCTTTATTTAGAGC
GTGCGCAGATTAATAACAAGCAAAAGTGTTCCCCGCCGAG
TCATGATCAGGTCATTGTTAAGGCGATCATGCGTTCATCT
GCGGCATCAGTCGTGAACCGAGTATTGACAGATACATTCC
CCTTGTTTTGTTTAAGGCAGGCACTGTTACGGACTTCCCA
GCGTATGAAACAGTTCCACTTTACAGCAGCGCTTCATCAG
CTGACGCGTTTAACATGAGCAAACGATACAGCGTACACTG
ATCCCAGCGCAGGGGCGGATTTACCCATCAGCAAAGCAAG
CGGCTGCTCACGGCCTGTAGTGGATTCTTCAAAGCCGAAT
CCTTTAATAAGAACTGGCAGTGGCGTTGATGGAAGATGTA
GCTAGAATAAGTTCTGCGGATTGCACTCGGTTAGTTTAGT
GGGCTTATTATAATAAGTGGTGACTCTTTACAATAACGGT
ACATCAATAATGATGTGTTAATATGTAAAGTAAACAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
piezo2a.2-201 Contained in:
[Fosmid] CH1073-433P8 (1) (order this)

OTHER piezo2a.2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055958 (1)
  • Ensembl_Trans:ENSDART00000153654 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL927075 (1) 538bp
    CITATIONS (2)