Transcript

ccr6b-201

ID
ZDB-TSCRIPT-131113-4030
Name
ccr6b-201
Previous Names
  • ccr6b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055883 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055883|OTTDARG00000038975|ZDB-GENE-030131-8888 ccr6b|OTTDARP00000043812 ccr6b-001 LG_ CU695194.22 Danio rerio protein_coding KNOWN, 1373 bp
CTCACACACATAAAGAGCAGAGCAGAGCAGAGCCGAGCAG
AGGAGCTGTACTCCACGGCAGGTGCTTCACAACTCACAAA
AACAGGTCAGCGGAAGTACAGTTATGGATAACGAAACGAA
TATGGACCTTGAATACTCTGATGATTATGCAGAGCCTTGT
CCTCTGATGTGGTATCGCGACCATGAAGTGACCGTCCAGA
CCTACGTCTACTCCCTGATATGTGCGCTGGGCCTGGTGGG
CAACGTTCTGGTGCTCCTGACCTACGCCTTCTACAAGAAA
GCCAAATCCATGACTGATGTCTACCTGGTGAACGTGGCGC
TGGCGGACCTGCTGTTCGTGGTGGCCCTCCCCTTGATCAT
CCACAACGAGCGCTCCCGCTGGAGCATGGGCACGTGGGCC
TGTAAGCTGCTGCGCGGAGCTTATAGTATGAATGTGTACA
CTAGCACGCTCCTGCTAGCCTGCATAAGCGGAGACAGATA
CATCGCTATTGTACAGGCTCGACGCTCCCTCCGGACGCGC
TCCCAGGCGAAGGCCTACAGCCGGATCATCTGCTTGGCGA
TTTGGTTTCTGGCGTTCGTCTTATCTCTGCCGACGGTAAT
CTACCACCAGGAGAAGAATCAAGAATGCATCACCATCTTC
AGTGAGATGGAAACCGCACGGCTGGTGAAGATCCTGATTC
CCAGCATGCAGATGGTGTTTGGGTTTCTGGTGCCGCTGAT
GGTGATGGTTTTCTGCTACTCATGGACCATGGTGACTCTT
CTTAAGGCGCAGAACTTTCAGAAGCACAAGGCGGTGCGTG
TTGTCCTGGCTGTGTTTTTCGTGTTTGTGCTTTGCCACCT
GCCGTATAACGTAGCATTGCTGGTTTACACCAGTAAACTG
TTTGTGGAGAGGAGTTGCGGGGAGGAGCAGGTCACGCTTA
TGACGCTTTCGGTTAGCCGGACCGCAGCGTATCTGCACTG
CTGCCTCAATCCCATCCTCTACGCCTTCATCGGGGTCAAA
TTCAGAAGCCACTTCTGCCAGATCCTGCGGGATCTGCGGT
GCCTCGGGAAGAGGTACATCTACTCAGGACGCTCCTCACA
GCAGACGTCGGATTTGTACGTGTCAGCCACTAAAACGGTT
GCCGAACAAAACGGCATCAACGACAACCCGTCGTCGTTTA
CATTGTGATGTGACAACACTGGATGTCGTTCAATGATAAT
TGCGCACGTTTTTCGCATTTATGCGCACAGACTTATGAAA
TCTTTCGATGTAATTTTGTAAATGCGAACAGCTTAACCTT
GTTCGCAATCTCATTTGTCTGTTAGGGAATTTGGAGTCTT
TAAAAGCGTGATAGTGGCTCAGTGGCTAGCATGATTGCCT
CACAGCAAGAAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations